60S ribosomal protein L35

cDNA: Genbank BC055640

 

hi258 is in the first intron

 

catcaatcgccccatttaagaggagaatggaacgctccatcatccctccc

gcactcgtttagtttctcccgtaacccggcagattttcccacgtgaccgc

tgcaacttcCTTTCTTGTGGCAGCCATCGAGAAAAATGgtgagggttttg

ctgaaaccgaacaatctaaaccaatcttgtcgaaaatacgtgttaaatca

caacgagagcaggttttatagaaactttaaattgaacgcttgactttgag

tccagtatttcaatcgatgattttaaaataaattgttttttgagtgatga

ggcgatgcattgggtggcctcctgaagctgttcagacgggttagcctgtt

tagcctagcatatgatttggagcagctttaaattgcgtttctaaatactc

aaaaatgaaattatcgatctggatttccacactttggctttcagttgata

aaagcagttggacgtaaattaaatcttgtaaaacacgtttatttgatcgc

tttgagctgacatgcgtctccaaactgtcgacattagtgatatttatcta

acacattagtgatatttatgtaacagtcgttgtgtattcactgtgcaaat

gtcaaaagcataagtttagtttggtacgtctgtgcttatgtttgtgtctc

ctatctatatacgaacacacaccagtgttgggtgtaattactgtaattag

attacttttaggtagaaaaagtgaagtaagggactacttttagtttccag

hi258 (5-3)

gtaatttaattagttcattgtaatgtacttgtgttaatgtataaaggaaa

cagttctggataaatcaatcaagagaagcagaattatgaatggatgaagt

cttgagaaacactcaatgaaaatttgtatgaatattgtcattgactttgc

atattttgttacatgtttattattcttaaggtgttaccatttttaatact

gcttaaatgacctgtttggctgtaagttgagtttattttccatcatttat

atggtattgagatttatatgtaatgcgctgaattttaagtcaagttgttt

tagttgagtgactgagttacttttcagacacagtaaaaatttagtttaaa

tacaaatttaatgatgtattttttgaagtaacccaacactgatatgaact

aaataaacttgttctttttaatactttgtacaaataaattctgagtacgt

aattttacattagcattaaaatgtttagtttgtgcgtgaatgttaatgag

taatttgtgttttagGCAAAGATCAAGGCCAGAGACCTTCGCGGAAAGAA

AAAGGAGGAGCTGCTGAAACAGCTGGATGATCTGAAGGTGGAACTTTCCC

AGCTCCGCGTTGCCAAGGTTACCGGTGGAGCTGCTTCCAAGCTCTCAAAA

ATgtgagtgatggaggtagacttgaatcaggctcatgtctactactaatg

ccaagttcagactgcatgattttcaaagtagtcgtgtcggatgttttcac

actgcttgactatctgggcttgcgatttgtcgcttttttgtttacactgc

aagatggatcggcgacaggggctttcacattgcatgactttacaatagga

agaatcgccaacaacttcgtcttaactactcattacaactaaaaacacgg

agtttatcttttgttattaactacataacaaacaagaagcctttaatggg

gtagaaaatgtacatatttgcccacctgggtttgaagggaattagccatg

tctcctcgacttagccatacctttcccgacagaactgggtgctcctgtca

aacctccactagtttttcgtccatttcttgcgtctaaataaaccgaaaat

gagcgctttaaacttctcccctagcctcctgcag