fibrillarin

cDNA: Genbank AY648785

 

hi2581 is in the 5' UTR

hi3580 is in the 1st intron

 

tcgacGCACATGTGGCCACCTGATCAGTGCAGCAGCAGACCGGAGGAAAA

GCGGGACTGAGTTAACGCCAGCTATTTGTAC

hi2581 (3-5)

AGTTAAAACAACCGCACAAAATAAGATAAAATGAGACCAGgtaagttatg

tacacatttcgattttaaaagctaaagtcaacgctataaaata

hi3580 (5-3)

taatccaagtaacgctgtttataagtgttggtttagagttagccggatga

gttagccacgcacttgcagttttgtgaaagaaacgctcgttctctttaaa

tgtcatggcattgttatttaatttattacaagctttggtgtagaattgtt

aaaaagtgattttgttgtaaataacgttatttttgtacatgtaaataacg

ttacacatgttacaacgctgcacgtgcgtgcgaccgagccatgctgttac

acgcggtgctgaagccccacatggcttttaactagttagagataataacc

agtttgcttttgtttctgaaactagttgtctagttaatgtgttttatttt

aaatggtgagttttgtgtaactttattcaactttttgtacatttgagttt

gtgcgttgtcgagttattagaagtaacgttagaggaatacacgttttttc

ctcttgtacaataagtagttttgttgttgtggatgaacaaagacataaat

acacccaaaacagaatgtattttgagcgagatgtaactgttgtttgttgt

gtggtctccaaaagtggggtatattcacatggacttgaggtaaagttagt

tttacattcacacacagggactttctcaaaaatattatttgcaaattcta

aataatgaaatcattttagcagcgagtgactatcaaagtacaatattgct

cacagttaaatgcgtagtgcttgtgttatttacagtcaaatacagtgtca

atgtattcgagtcatacttgcttgtaatttcagaccgaatattaaaagta

caaacgttatagtaaacaatataggaaacatgtcacaagttgtcactgaa

tgaatgtgtgaatataaactttttcaatcatttaaccctcttaatgctgt

catttagcgctctaatatcatgacattcgacttcttatttgccaagagaa

gggttattttgtatttatgaaacatcaactaaaaccatgttgtctgaaca

gcagctgttcattgagtgaatgcagaaaaggtttttgcaattatttttta

tattaaatattaaagatagactaaattttttaatatggatttaattgatt

ttatatggattaaagtttttatatggattctgactaaacttttatatttt

ttacgaaacgtttttgacacctaatagtaattcattctaaaatgacacga

aatgaaaagtaacttcttttaattggttctgtaccaaatatatatgctac

aaatgtaaccattaaaaaaagttaatattttgaggctttttaagcatttg

gaaagttttagctttttacaaaatgaatgttttgtttttgtatgtcttca

ggcccaaatgtggttactaatggatttcataaatttgtgtgaatgcaatt

ttgatttattaaaagtttccataaatgcagtacagcagacttgtttttgg

tacttcggacagtgcaaagttaaaaatgtgctctaccataccacccggtg

aaaacaagaaactataaaaaatgtttttctggttattgtaaggagtcact

tgcaactttaaactggtttagtaatagtatgatccacaaatgcgtttttt

ctccttttcttttaaatgttttgctctttcccttcatcaaagtaatattt

ctcttcagGATTCAGCCCAAGGGGAGGTGGTGGTCGTGGAGGATTTGGTG

GAAGGGGACGAGGCGGAGGAGACCGCGGAGGAAGAGGAGGATTTCGAGGA

GGCAGGGGTGGTTTTGgtaagcaggatattaaagcagttttattttactc