60S ribosomal protein L23a

cDNA: Genbank AY561517

 

hi2582 is in the 1st intron

 

gtgaaaccctgcaatatactgaaggaaaccCCTCTCGTTCTTCCTTTCCC

AACATGGCCCCGAAGGCGAAGAAGGAAGgtgcgtcagatttatgcatttt

atgttataaaaataaagtttgtgcaaattatatacagttttattttcatt

caaatgtaagtgatgtggttatgttcgtttctagcaattttttcgccgtc

tggagtaggaaaatacagctatttagtgcgacgaagctggagtgaaaaga

gcggctagcaagctaatcattgaactacatgcgctcatatggtgtcatta

catcagtctttctgcgagttaaaagcattgtccagttgtcattaactggt

tctcattttttattttgagagtccagagtgaaaaacaggcaattgacact

ttgttagcttgtagttagctcgtaacgttaacacacacgtggttactcgt

tcttattactt

approx hi2582 (3-5)

tttcattattagtcagtttaatattcgtgaagtaaaaagcaactggatca

agctataaaacttttaggctcaaaacattccaacgtgtccttgaagcatt

ttatagccgattcctcaatgtaaacaccttcatgttcacgtacaattgat

ttggttgtaacgttaaaattttctgatttctgttgtaaatgattgttttt

attttagctgttatcacgattttaaatgttacattaattttatagaccgt

tttgttgtgagtgtttagacaggggtggccaatcctgttcctggagaact

accttcctgcaaatttcagttgcaacttgcaacccttatcaaacacacct

gtctgtaattatcaagtggatttcgggtcctacttaattggttcaggtgg

gtttgatcagggtaggagctaaactgtacaggaaggtagatcttcaggaa

caggattgagcacccctggtttagaataaagaaatgtttctaacaaagtt

gcttatgaagtacaacaggcgaagttttataataaggtcatttgatgcat

ttacatcagccgtgagaaatattaaagttctaatctttgtcaaaacttca

aacagtattatgaatttgagatctaaaacgtgcattaaaccaatattgta

tttctgaacatgtgcatataaaattataaagcaataaactgatttaataa

atgaataaaaatctatcaaaaacgttctctttagtttagggctgcacgat

atatcgtttcagcatcgacagCTGTCCCGGCAAAGACTGAGGCCAAATCT

AAGGCCCTGAAAGCCAAGAAGGCTGTGCTGAAGGGAGTCCACAGCCAGAA

GAAGAAGAAGATCAGGACTACCCCGACCTTCCACCGGCCCAAAACCCTGC

GTCTGAGGAGGCAGCCCAAGTACCCTAGGAAAAGCGCTCCACGCAGAAAC

AAgtaagacccggacactgctttgtgttttagtgtgttaaattttgaatt

ccaacagaaacaagaattactttttttatgatgcaaatgatgggaattgc

gatcaaagcatgaaaataatgtgattacgcttttttaaaactgatgcatc

ctcatgagaacttaagtaaaacaaaacgtttttccagaacatgagtgagt

ttataacaagtgttgctcttgttctgccagGTTGGACCATTATGCCATCA

TCAAGTTCCCCTTGACCACTGAGTCGGCCATGAAGAAGATCGAGGACAAC

AACACTCTGGTGTTTATTGTTGACGTAAAGGCAAACAAGCATCAGATTAA

ACATGCCGTCAAGAAACTGTACTACATCGATGTGGCCAAAGTCAACACAC

TGATCAGgtataactatttattaatctaggcatttttaaacagtggtttt

caactttgccgtccagtgtgcacatggaataaatatgta