lysyl-tRNA synthetase

cDNA: Genbank AY648786               

 

hi2586 is in the 1st intron

 

tatttattcaaaaaacaaaccacttacgagaaaaggaagtgatgcaactt

taagcaacggaacttttacagtgaaGCGTGGTCGAACATTAGCCGGTTTT

ATTGCTGCAGTGTTGTTTATATCTGGCTTCACTGTCCTGCTGCGAGCGTG

GAGAAGATGGCAGACGGAGCTGTGGTGGATGGAGACAAACTCAGCAAAAA

gtatagacatttacacaattatagcgcttaggctgcttttgtgcgaacta

aaacctaagataagttggactgtgtgcgttgcgcgacgttcatactctct

gttgtcttgtaagatccgttgtgatgaagtgcaacgtggtttgttctgcg

tgaacgcgactgaatgacagcgtgttttgattacgatttaatgcgtgtaa

atgattctctcttgttggcatatttcaggatcagtcaacagtctgtttta

cctaaattaatcttaaaatgactcacacgttctcacttcatcctccatag

tgcgccgagaaagctaatggcgtgttcgcttgagactcatttccgt

hi2586 (5-3)

gaccgtgtaaaataatattcggcgactattttacgctgagaattcgtcaa

atatttgttatcttaccttaaatgcgttaagtatgttaatataatctttt

ctgcgcttctgtcagttaacggaactaaagtactttcgattctgggg

 

approx 2.7 kb to next exon