eukaryotic translation initiation factor 4A, isoform 1A

cDNA: Genbank BC048899

 

hi2596 and hi3822 are both in the 1st intron

 

atcgttaactaaccaatgagagttgttactgggcgggactacaggctgac

tgaacgggaagacgtccaatcaatggactttgaacatcgtcacggtttaa

gtatttgcgcgtttccgccagtctacagtccTTTGTAATAATGTCGTCTG

AACATGAAGATAGgtaagataacgtgttcgacgaatgtttcttctatctg

ttaaaatattgattatttatggaaaacaattaattcttatcgatttaaga

tgtattgtagtaaaagattgttcatcagcggtttaaaaactagcattatc

tgccgatttggcatgttcgtgctcgccctgttcccgcctcgttaaaatcg

tttagaaaagtgtgtttttaatccagtttcctgcgattttgtcgttttgt

tttaggatatcgtattgatgttaactaaaaagtgttttaagatgaattgg

tgccatattttcgatgttccgttaaaatgccggttcttgtgacgcaacgg

tgtctcacgcgctgcttcagtacatcgtgtgaccggcgcgtccatgcggc

acatggccgtttcatttccctcgttttgaaccgattgcggacattttcaa

cattcattgttatgtactctactcgagaacattgtttcggatgccatcca

ttattaaaaccgactttgttggcagatttaagccctcaatcgagaggata

tgtatggcacatggcctttcatgggcgagacaatggagtgtggtctggga

gtataacgttaggcctaacgtcaaggcctgttttcaaccatttcaaacca

actattttctaagattaaaattttataactttaaagggtggtatttttat

ggatttaaaaagaagcgaagcggtgtcgttgtttaatatgt

hi2596 (5-3)

aacttgatacactgtaacttcataatcgagaaacatgcgtgttaattaaa

tggtatatcaatctgcgtggttatgctgtttcgtgacgttttttataaga

ttggatgttgtag

hi3822 (5-3)

taatagattaatgttgaatatatgcgaatgaatgtgtctcggtggagcca

cgttggtaatggcgctgagcgaaaatggctgcctcttggtaacgtagatt

tcagaggttgctatatcagtgtctttaagaagttctgtctcagtttaact

aaacgataatgaacatcgaaaaacaaacctgtcggacccatttgtataaa

aagtaatgttaggtggagtgacagtctccgtcaccgttactttcagtatg

tgggaaataacgcaatgaaagtgaatagagattgactgtgactatgcctc

aaagtctgagcgcttttttggggggggggggtgggtttatatatatatat

atatatatatatatataattaaacatacatgcatacattctatgcagtag

taaagttcagttaatgtgtcctttggagatgttcagattttggcactgag

aaataaattttgcgaaatgagttgtcaaagtactaattacaacctcttat

tgcagACCCAGAGACAATGGCCCGGAGGGGATGGAGCCAGATGGAGTCAT

TGAGgttggtgtctcttaagagccatttcacctaaagtatttataaccac

aatattgtatacgtcttggtgtctatggatagcaggaatcactatagaat

aaaggtagtaattagatacagatattacatataactaaacatagtgggtc

atgaatgccttatctttgat