replication protein A1

cDNA: Genbank AY648787

 

hi2618 and hi2877b are both in the 1st intron

 

tcctcggttatttcgcataaccttgtgaaagaggaatttggatcctcctg

tgtcgtatgtattttgacattcagcggatgtagtttgaagccggaaacgc

gtcatcgtgtgcagcagcactttcgcgcgtttggagagttggcgcgaGGA

AACCATTGGAGGAAACAGGAGATCGATCAGTTCCCGGGTCTGTTGGAGTC

TTTTGTCGTTGCAAAATTTAATCTTCCCTCCGCTATATTTTTGTGAAAAG

ATGACTGTTAGACTGTCGGAAGGGGCAATTGAGgtgagttcacaacagca

gagttatttttaaccatcgcagacgtaaacatgctaagtgagttagccag

ccacaagtttttccccctgcagtttcagactatgacagggaaattttatc

aatttattatcacagttttgtgtaacgttagtttttcttattaacgttaa

cagcattttgcgatgattaagtcttatcgtgtcaacttttcgttgagacg

ttttttataaaaacgtaaacgatacaacactcagtcgggtttattgtata

tcgttaact

hi2877b (3-5)

ttatgcaaaatggagttttaaatg

hi2618 (3-5)

tgtatgaaataaataagatatctaaaatctcccatgttttgatttacagt

acgtggcaataagtggctttaacttaattcttttgttgtgtattttttct

ttgcagTCCCTTTCAAAAGGAACTGAAGTCAACAACCCTATTCTTCAATG

TGTGgtaattgtcagattctctgtacattgtttacaatcgatcaaatcat

ttcatttcagcaacttattataataattttcaagatttgaaagttaaaat

gcaagggacctccatccccaaaaataaaatgcatgtgatttcttgtgttt

agaaatttaaccttatactgagaatatgctggataatataatactaactt

atatttgccattatatgtattatatttattaaatttagtgtttattttta

tttatgttttacattcgtaaaaacccaagtttatggaataatcattttat

atattatattttttatttttttattattattttttattttttgcagtttg

catactaaagattaaggtttatgtattatgggttattttaatccaaagtt

tttttttttgtttcatttatactgatgtgtctcgatatgatgttttaatg

taatacacatctcctaaaaatatcttaacttcttaagtttaataaaatgc

tttttattttctttcttttttgttactgtttttatcaaagccattgtgcc

ccattgcagtgatctgaaagtctgaacagattaaaaagcttttggaagaa

taatatcaaagcctatatagccaactttatgaggggagtaaaatatttca

aagattaacatttgatagccacaatttgtaacattttaataggcttaaac

aaaaatgttagtaaggttaacagacagttaaattatttatttttatttat

tttgtttttgtatgtgtcatatcagttttatttttgtaatttatttattc

atgtttcatttactctttttaatatatatatatttttataaaatatatat

ttagtttacatatcctttactttttctttaagacaattttatcacctatt

taaagccgtagtgtcaaatatatagagcaagacttaaaaatgttaaatat

tcttcagAACATCCGCAAGATTGATGGAGGTAATGGTGTGTCCCGTTTCC

GTGTCATGATGAGTGATGGGCTGCACACTATGTCCTgtaagtataatcag

tctacagaaatctgttctttacatttattgtaattcacatgcttaggatg

tgtt