RNA polymerase II subunit B

cDNA: Genbank AY648788 (and 5 UTR from BC095078)

 

hi2635 is in the 1st exon

 

gccagtacccgcgtagagccgcagaaccgaggctccaagaagcctgtaca

ttattccgtcaactttataaacacagcgccatcgctagactcacggccac

cttgactatccagcgacccacgtgagttgcctgtcgcacaattgtacgtc

actgattttagaacacggaatattacgttaaaaataacattttaactgtt

tgactctatattaaacaatgaatgtgtggtatttaaaatagtaaatagat

gaatatgtaggatgaactaaaataaaatcataagagccggaagtggcgta

taatcccgccgccgcctGTGTTGTCTTCAGAGCGGCTCAGACGTGAGACG

CGCGCAGAAGCTCTGTTTGTTATCATCAGAAATATTAATAATACGCGGTA

CAAATCATGTAT

hi2635 (5-3)

GATCAACACGAAGgtatgtgtgaggacttataagctcactatgtgcttat

tggttgttttggtttagtgaaatatgtgatttaatacctaattttcaagc

gttaacgcaacgtatatgctaaccggctaacgttaactcttgctttgtca

gaaatgagctaaacatgcatactaatataactattgtagatttaatacaa

ctgtaggctttaaatattgcttattaattgtgtaacttgtgttttgtttg

ctaggccgcagtatgtaatgttcattttaggatataagttaatgtgttgt

tgttaaactctgtattattagacatgttgaagtaaatactccataatcac

tgcagATATCCAGTATGATGAAGATGATGATGAAATCACCCCTGACCTGT

GGCAGGAGGCCTGCTGGATTGTTATCAGgtaataaaaccctgctataatg

gagaaactacataaaattacatgtacaaaactgactttatttactgaaat

cacagaaaatgtgtataaagttgtatatagttgcaacaagctgtgcttat

tacagt