TATA box binding protein (Tbp)-associated factor, RNA polymerase I, B

cDNA: Genbank NM_001025298

 

hi2639a is in the 5' UTR

 

tttagttacattccagacaatataaatgattaacaacataatatagagca

aatacataaaataattatatgggataatataattcctacaatgtggcaat

gtgcaaattgggggctatgccttgttatctaaacttgaagtatgaattat

tattattattattattattttgattcacatatatttatacaatataatta

catttcattaataaaatagatgtttaaaattatacgtgtaaatgagttga

gttatactgtaaacgaagaaaaaaataaacatcaaaattgtaattaacat

gcacatatacatattacacaatatagtaaaatgaaatagccctaccaaag

ggttctagatcagtgggccagggcctactgtaaaattttacgctgaacaa

acgagtgacttttattatgaaaaacgtatagtcggccatgttgaaagcga

gtatgctcacgctgaaaacagaaaacaaaaattgtctcatgTTTTGAAGT

TCAGCTTACGTTTA

hi2639a (5-3)

CACCATGGACGAACAAATTACTgtaagtatctctagtgtgtattttgtca

gtctgcagtgttatgtggaaattcgttatactctgtgagctgcggtgctg

tttctccagGGTGGATATAGTGAGCCATGCGGACAGTGCGCTGCTGTGGA

CTGGGGAGTGTCAGACGAGGGTCAGTTCTTCTGTAAGAGCTGCCACAATG

TCATCGAGgtgggttaatagatattttaatatatagtacattaatacata

gacagaaatcactttttttttacatatgtatagttcttccaattcctatg

agcttgtttaaatgcatggacaggtatgaagttgtcgtatgtattataat

ttactcacttttctgctgattttcattatgctgctgactttaatagttat

attaacatttaatttaatgattggttaattaatttaaaaaaaatcattaa

acaaaaagctaattaaagcaggagttgggtaaataaatattacta