suppressor of defective silencing 3 homolog

cDNA: Genbank NM_001003493

 

hi2639b is in the 1st exon

 

ctcataagtcatttcaaaatgacattccgtacgcttacctgaatgttata

aggtttcatgattgagaagtgtttagccttattaacttcagaaattcttc

ttgttccttgaatgataataagaacaatacgcggacagagtactctctct

ttctctctctcccccttcccatttcttctttcccttatgtcataattgcg

cacaagcggttcatactacatttcccatcatgcgctgctcgagcatctcg

accaatcagattcctcggcctaccctcccgttgaaaaaaagaagaggctc

gacagacTGAAAACGTTGTCGGTGCTGTGTGATTGTTTACACGTTGGTAT

TTCCTGCGGTGTTATCAATATTTTAAACTAATAAATGGCCTCGACTTTAT

TGTCACCCATGGTGGATTATTATAACGACGAGGAAGAGCTAGATAGCGTT

GATGAAGATGAAGATCGCAG

hi2639b (5-3)

TTTCAGAGGCAGAGACTCGGAAGAAGgtgaatacgcacaaaaatagccag

tttacattttaatacaattatataataaattattgattaaaattatcatt

ttagttgtgaacctgtaagttgatagctgtttgagcgccgatatatgtta

acgtaatgaaagtgtatgcatgtgtttcgcacttgtatgctcgctgggtt

tttgcaacttcatttgaattattttatgtttattgtgatcgttttagacg

taaatagggactgtgtgggaatttaactacataatggctataaatgttgt

catacttgtgctttttgtgctatccagcctgttgataaacaggtagcaga

gtccgcataacgttacgtcaggaagcatgaagttactaagctgttaaaag

gcttgtaaaatgagacccacttatttgtattaagatgtatcagaggaggt

tcttgcattcaaagtagaacattaaaagcgtgattagttgtagttgctaa

gaggtgggttggttacttgctcagatgtaggacagaagtggtgttgtaaa

gatttgagggtatttagctcgaatt