Fbox protein 5

cDNA: Genbank AY648791

 

hi2648 is in the 1st intron, before the ATG

 

aaaaagggcgcttttttccctgaagcgcttctttcatggggtggcgctct

ttatgggcgatgacgttacgcttgtatctgcgtcatgacgtcacatctgt

attccgccaaacgcgttcattggccgtgagacctttaaaggtatcttgca

gcgctctgattggTCGGCGCGATTTGTCGCCAAATTCAAATCCATTAGCA

GTGGCGCTTTTTCCTCAAACTCACAAACCATTGTGTTGCCGCTTAAATGC

TTGAGCTACCACTGCAATAGCGACAAGGGCGCGTTTATACGGACATATGA

GGACGACGTAAATATTGATTTTAACTTTTTAGAGgtaagataataacgtt

ttcctgtcatatccacgtatttccgttaaaattaagacttttaagaggct

tttaaatcagtagatactagatgttctgtcatgtttgcgtttccctttta

agttataagctcagttttaggtgtagaattgcgtttttgttcaatattag

tcaactattttttatctagaacgtattttatgtgtataaacatattttgt

agagtatgctaaagctaatatgtgcccttagtagtgtacatcatgagttg

tagccacgtcaggaatgcaagcattaggcgcgcaaaatgcaaaacgcaca

taaatcgcgttcaaataaaaactgcacttctttaacttttaagcacactt

aatattaagcatatgtatatattttaacatgcatatataatcacaatgtc

ttaaaatgtgaggtcaaactaatgtgctccgattggagcataaaaatgtg

gagtaagttaacatttattacgtaatacagttcttaatatgtattatttt

actatgtttatgtgttagactcataaca

approx hi2648 (5-3)

catcattataatcagtaatgtgtatgtattttaacatgcatgtataactg

gtgtagcttaaaatgagaagtcaggctaatgtgcttggttttaagcataa

aaaagtggattgagtaacatttattacgtaatatagttcttaatatgcat

ttaatgtgtattatgtattagacccataacacattacaataagcccttta

ttgttatatgtttaatgttatagtactttattaatatattaatttatttc

agtaatgtattaatgtatcagaaataaacatttgttcatcggtttctctt

gtcttgtgttttgctgtaatggcattatattgtttattttcagtagttgt

atgctgtaaaaatgtgtaaccagttttttttgatccaacactctttaaaa

tgtagtttgctgtaaaataaaatttgtatatgcatatttatcaatttctt

attttctgtactttgctgtaaaattgacataactatatcttactatatat

atttgatctatatagaccaatagatgcagattcaaccatttacctggcac

acttaaacatcatatttctcatattctgtagtttgctgtaaaattatgac

ataaccagatttaaccacatatatttgatctatatagacctatagatgca

gatttaaccattggttaaacacactatatcatatgtataaccaaatctaa

ccctatatatttgatttttatagacctgtagatgcagattcaacaattta

tccaacacttaagtaccatatattcatcatctgtagtttgttgtaaaatt

atgacgtataaatctaaccctatgtatttgatctgtagatgcagactaat

aaaaagctatattcccaacagatggcaaacagattgggatcagtgcccgg

ataataaactttctgaaatttagccagaactaggaagaaaatataatatc

taatttatttttctaacaacgacctgatgagattgcttatacaagatgct

gcattggacacaagactcacacatgaacatttactcaaaggaggagagcc

cccaaattttctatatttcaacagaaaccaaaccaaatattcttgtggaa

tgccccatttttaatgttatcagacaacaatttttatctggagagacttt

aaatgaaatattttttaaatgtgaatccatttaaaatttttattacaagg

aaaccttaaactgttttagatttttttttatcttattatgattattatta

ttaatttattttaccttttttatttattgctgttgatgatttttaattgt

tagaatatttttataactatagaaaatcggtatttataacatatggtaaa

cttaatctgtttttttttttttttttttttgccatgacatagcaatagaa

gctgaaatgacaataaaattaaaactctttaacgtcaaattatttttttc

ctcgctaggttcaacgctaagaattgtttctacttgtccgatcgggccaa

tggttcagatttttacttgccctgccaaattttccactggcaccaccaaa

aaatttgtaatttaatagctattttatagccacatgttttaaatagtgtg

tcaaataatgtctataattatttaaatgttgaaaatgagcaaaatgatgt

gttaacaaaacaaaaagagcagtaggatgatctttatatatgatctatat

atatatatatatatatatatatatatatatatatatatatatatatatat

atatatatatatatatatatatatatatatatatatatatatatatatat

atatatatatatatagacctatatatgcatgtgtaaccatttttctaaca

cgcttaaaggtcatatttcttattttcagtactttgctgtaaaataatgt

atgcacaattaaccatttatccaactagcatcaacatgtcttatttcatt

actctcttctagTTTGCTGGTGTCCAAATTCTCCTCAATATGAAGTGTCC

AAACTACACTGAGGATTCCACGGTTTTATGCCACATGGAGAAGACTGAAA

CAGACCTGGGTGAGGTGAAGGGCCATAAGGTTTCGCCACGAAAAACAGGA

GCCCTCCCCCTGCGCTCCCCCGCAGCCACCAATGTCTCCACACCTCTGGA

GAGCCGAAGCAAAGGCCCCCATAATAAAGAAAACTACCAGAACAAGAGAC

ATTCACTGGATATGGCATCAGATGATGAGgtgaaacgacaatcattttta

gccgtgtgtacatgtgggacgcgtgttaaatctttatattctgcactatt

tgtgtgtgtgtttgttttggtggtgtaaaaagacagaatttatatgatga

catgggtatgacctaggctgcgttgcactccacttttagaaatgcacttg

tgaacttctccat