40S ribosomal protein S15A

cDNA: Genbank BC107523

 

hi2649 is in the 1st intron, before the ATG

 

 

ccatggcaatttctttaaaattattttcaggatgtagaaatggataaatt

ataacatacattatatattaatatgttaagcaccataaattttaaatgca

tttaatagattaattgtaggaacaaaaattatataatatttgtaaaaatg

ctaaaacaatcaaataaataaacatactcattaaaaagaaacgttataca

tttaaataaatacatgtaaaaatgaaacaaaaaacttttgattaaaatat

gtaaatatatgtttaaagacactatcaatgaagtaaaaatgtaacttaat

agaaagtacattttcaaaataataatttacccatagggtggcacggtggc

tcagtggtcagccttacaccaataaggatgctggtttgagtcatagactg

taaaaaatgtcctggctgggccagtaggtgtttctgtgtggagtttgcat

gttctccccgtgctgacgtaggtttactccaggtgctccggtttcctcca

cagtccaaagacttgtgctataggtaaattgaataaactaaattggccat

aatgtatgtgtgtgaatgggtgtttcccagtactgggttgcagctggaag

ggcatctgctttgtaaaacatatgctggataagttggcagttcattccac

ttgtggtgacccatgatgattaaagggactaagctgaaggacaatgaatg

aaggaggaaaaggaatatttcactaaataaagtcccttacacaatgttaa

tggtgtccccttatttatagaaccaacatgtttcgcaaaacatgacacct

ttgtaaagaataaatataaatatatattatatatttacaatgccaattaa

aaaataaagttgaataaatactggtgcacttgagaattggtcaaattcag

ttgtatagtagggctcagttgatttattctgagactagaggcgttgcatt

gcaatgaaagactctaatggagtcaaaaatggccataaagaaaaacaaac

aaagaaaatctttaaaggatgcgacgtaaattatattttgtaaacaggta

aatgcataagggtgtttctgtacggcgctccaaacaaatagagggcagtc

gcacagacgcgtcagcacgcagcgtccttctacattctcgcgagagtaca

tttttccctaatcgcaccgcgcgccccgcttccttcCTCTTTCCGCCATA

TTGCAGAACTGgtaaggctcaggattcttcattgcatgtgtaatctgttt

aaaatcacgcacatcgtcactcatcatccacagagagagcgacatgtagc

ttcacgaacaccacaagcgctagatttttaaatcatttggccagtcgtgt

atgtatgaagggataaattacccagagtttcatgagcgttcaacctctcc

atcgcccagtaatgcatttccatgataccgagaggcacacacgagacaaa

ctaaagttattattaacgccggtgccttatttaacatcactaatgtgtgt

tattgtgaagtacactagtcaagggtgaagacaagctcacatagcggtta

tctgctaacgaattcatgcaccgcttaaacgtgaagcgctctcgatgtcg

gagaaagtttgagccgggttttgtttgaaacta

hi2649 (5-3)

acattacgtttccctcaaaacacagttggactctgtcttacgtctacccc

gttgatgtacatctgctgctaaattggccatatgaggctgtgtgactgat

gtaatgactgaatattgtataaatcctgtcctgttcctcctcctcagGCA

TCATGGTGCGCATGAACGTTCTCGCTGATGCGCTGAAAAGCATCAATAAT

GCTGAGAAACGTGGAAAACGCCAGGTTCTCCTCAGGCCCTGCTCTAAAGT

CATAGTACGCTTTCTGACTGTGATGATGAAGCATGgtgagttacacattt

agttttgtatatttgaagaattctgttattttgaagcgttattgtcaaac

aagttgctcgttgattgatctccgcagGTTACATTGGTGAATTTGAGATC

ATTGATGATCACAGAGCCGGGAAAATTGTTGTCAATCTCACAGGGAGGCT

GAACAAGgtgagtgtgacttgcaacactatgaaagaactgttagtgctgt

gctttagtgactggctaaaccagggctgtccaaactcggtcctggagggc

tggtgttctgcatagtttagctccgacttcctacaacacacctgtttgca

agactctagtatacccaagaagaacttcataattagccggttcaggtgtt

taatttgaattggagctaaaacatgcaggatgccgaccctccaggacaga

gtttgggcacccctttgctaaattgttcacaatcagctgcactttctata

tataatgtccagcactattgtcataatggcaaaattaggacttgcatgtg

acactgctaaaatatcacaatgctgataacttgctatgaaaaaaaagacc

aacacaaaatacttaaactgctgtacagatccaaatgaatgactgtggc