myosin-binding subunit of myosin phosphatase

cDNA: Genbank AY648792

 

hi2653 is in the 1st intron

 

ctacttcacataagagaatgtaataattgcccaaagactgtatggtattg

ccccataaagatgacgtcatgctgcagatccggagctgtgacgtcgcaca

ttctcgcgatatctcgacgtaaccaggtttgttcaccaccagtcaccccc

cctctctttcgtaccgtaccgtcccctcccacgccccagcgcgccgagtc

gggatagtggcagtataaagtatatcttccatccgagacagatAAGAAGC

GCCAGGCTCGAGGGGATGAACATGGCGGACGCCAAACATAAGCGGAACGA

GCAGTTAAAGCGCTGGATAGGCTCGGAGACGGACCTCGAGCCGCCCCTCT

TGAAGAAGAAGAAGACGAAGGTGAAGTTCGACGATGGCGCCGTGTTTTAG

GCCGCCTGCTCGAGCGGAGACACGGAGGAGGTGCTGCGAATGATCGATCG

CGGCGCCGACATCAACTACGCCAATGTGGACGGGCTCACCGCTCTGCACC

AGgtaagaagagcgttgcgtttcggcctggcctgtgtgtgaggtcgacct

gtgcattttgggttgtgtttactcagttcgacacctccaccaccaccatc

atcatcatcaccatcttcgtcgggccgttttgcggaaccgcgtagccgcc

gaagctaatcggacagtgatcgaaatggatatttgttttttatgtgctct

gtgctggttcgggcatcttagaataataacatatgtgcaaatgagtgtgt

gaaggggggaaatgactgtcgggttgattctagggtgtttgtgtgtatg

hi2653 (5-3)

tgttagctgctggttagcttgttagccgctcagatcatagagttttatgt

gtcagtaattttacaggttattaactcatggataaacttattaatgaatg

tgtatgagttgtgtttaatgtaaatttaaggagccgacttgtaaatgtgt

tttgatgcgctggtcaccattgaaattatgctacataagtgcatagcaac

cagttagcacggttgtgtatttgggagagaggctttccagttgacacgta

tgttgcgttgcagattattgacccaaaatgttgcgtttatggaggaaaaa

ctctgtccaacttgactt

 

approx 39 kb to next exon