cleavage and polyadenylation specific factor 3

cDNA: Genbank AY648793

 

hi2666 is in the 1st exon

 

tactcggaactacaccggaagtacttgtcctgtgtctacagcgtgtggtt

tccagttccacttgatcgttgtttggtattatTGGAGGTATCGCTAAATA

TGCAAGAAGTATTACTTATTTAAGATTAAAACCATCACAAACATGGCTAC

CAAACGTAAAGCCGATGTACCAGTGCCTGCGGAAGAGAGTGATCAGCTCC

TCATCAG

hi2666 (5-3)

ACCGCTgtaagttcacttcattcactgtctttaataacagttcagttccg

cgccaaatgttttctccacttactttactttacatttacagtttacatta

taattcaagacttgttgtacattttagttcggagtactgtaactattaac

gtaatgtttgtaacagAGGAGCTGGGCAGGAGGTTGGCAGGTCCTGTATC

ATCCTGGAGTTCAAAGGCCGCAAAATCATGgtaagcattgtttttgttgt

ctgctctaacgttagccttgatgtttgagcttaagtttgttttatattcg

cacttaaagactttcttcttaatattataatttcagaaaagtgttatttg

caaattccttatagtgaaatcatgtgatcagtcaaggactatcaaagtac

aacattgttcacagtcattaaatattgcaaatgttgttttgaggtcatac

cttcaaagtagcgtggttatcaatataggatcctcgtcacaagttgtcac

tg