RNA binding motif protein 22

cDNA: Genbank NM_213214

 

hi2667, hi2827a, and hi2994 are all in the 1st intron

hi4103 is in the 7th intron

 

ccgttacagtacggggcgctgtggcgtttcccccgcttcacagacgcaaa

gcattgtaggtacaggttccgttcgcgctaGCCTCCTGTAGCAATGGCGA

CGTCTTTGGGATCCAACACTTATAACAGGCAAAACTGGGAAGATTCGgtg

agtaggaacatattcattgttaatgtggttaagcagttttacctattgcg

gtctgttgtttggccgatcttagtaaacctttttactagactcctattca

tcattgtattagctcacggctaacaataccttttcatcattt

hi2667 (3-5)

aaatcaatctaatctattatta

hi2827a (3-5)

aaatatgtgtatatgttacctatattgccacacacttataagtgaatttt

aaattaagcgaacaacactccagttactgtaaattaacggcgttttgttg

taacgttacagacacaatcaatcgatcagttgaatgctaaaatcttatta

ggataagaaaaatgtgtatgatattaaacaaaatatttcttttaaattta

aagaagtacactttaaagttacgaatcacgtgtatccaacaacatatatt

ggagagagttttgtactttcgattttgaagcaattgaaaacttgtttttc

caatgtaatttggtcacttgcatacattttgggacgaagtgttagcttgg

atac

approx hi2994 (5-3)

agcagaaaatttctgtaagacttgtcttctcagtggaaattattaagttt

ggcttaatacttaaggataaaaagatatcttatataataaataatttgtt

tttatgattaaaatgttgaattt

 

approx 3.2 kb to next exon

 

later in gene

 

attatgtttgggttaaaatgcattgcttgaatctgacagGCATGAAAAAC

CCACTGATCCAGATGACCCCCTGGCTGATCAGAACATTAAGGACCGATAC

TATGGAATTAACGATCCTGTGGCTAATAAACTGCTGATGCGAGCCTCCAC

CATGCCCAGACTGGACGTACCGGACGACAAGTCCATAACCACACTTTATA

TTGGAGGCCTGGGAGAAAACGTCACAGACTCGGAGCTCCGgtaagttggt

tttcgggcctgtaaagctgtatttgagacaactttttgtttaaatcagct

tgaataaagttttaggctctacatgggcataatttatatgttttaatgaa

ctttttgcttttttatttgtttacttcaaatgatttgagtccatttatac

acactacggtttttgagtcacagatcagaccatttttctgattagcaaaa

aagagacaaatgtcatctgcttttctatttatacaaaaatattactgcat

tggttttaacaaacagaagttagtacctgtaattttaataaacaaactga

aaaaagtacaaatattcaatatgaaaaaggatctttggtactgtttggta

atgctaaatatagaaatctgacatcttgtacaacatatatttattttcaa

ttaaagattctacaattcacacataaaacttgtttcatgacaagtaacat

ttttaaaaacctattcagtgacttaattttaatggttgtttgtcgccacc

cattggttacacaatgtaattgttacattcaccagcgtcaagttccatta

aacggagattttaatcttccataaacatcagtctttatatctaaactata

aactgttctcccagtgccatttgattgtttgtaaaaaaaaaaaagtgtga

aaacagaatctccctcagtcaaatgcagatttgaatgtagcgctttgaag

gattaataaacgtatgcaaattattagggatgcaccgatagggatttttt

ggccgataccgataaccgataattcttcagacttggaggccgatagttga

tatatgttggccgataattataaatatttcaaaatgttatatttttacac

agcaaacttcataaaagctgaaactccgctcttttgaactggatagtcta

tactcaaagcaaaaaagctatgatttcaaaattgcaaggtgattatatag

acctatattcacgatttcacacaaatcagcatgcaaaaaatacattattt

aattttcttcatagcaaattaacatgcaaattgactgttgcataacatta

aaaaggttaaataacaaaatgggatttaattaacaagcaagttaaatata

ttttaaatgagatgaaaacgaaagagctaaggactaaaaccagctcaaat

gttcttgaatataacgggttacagtaatgtacatgtgtacaaatatgtca

tgtccgaaaaagccttttttagaggtgttttgacagttcagagccacagt

acaagtgaaaagctagatactaaatgtattatttttaaaaatgcgacaaa

tttatcctatttgggttttagattcttttgaacacatgtagcatcaacgc

ttctgtgttcgttcttgctgtcaatcgcggggaaaatgattgatgaaaag

tttatgataaaccgctgtgagggcgcagatttgccctcggattttgatac

aaacctgatcattgagctcagatgactttatgacaaacacagagcagaat

ataaagacagaacgtgtggccctatgctggattcagtgaccggtgcacct

aggctctcccctgttgatttgtgaaggctcaagatctgtgtgtgtgtgtg

aaggctgtcagatctatgtgtgtgtgcgcgtgcggtgaaagctctcgcgc

gcttgttataatatgaatattccgatcaaactgaatacaatcttacatca

gcaagacataggaagcaacgcgttgataataacaaataattatattagat

taaaaaccttccgtaaagtttttgtttagcgcgtcacgtgtgcaggtcag

tttggtgtgtttgtatgtgtgtgtgtgaagcgaagagggagagacagaaa

agagaagcgcttttttcgggtcctcgttcattcaccggctgcaactaaaa

gaaataaccccgaaactaatattattcggccctggactaataagtaaatc

tccctgctatctctaacacaacaaagagacagagcaggaaaggctttcat

atgtaatattatttcctgaggcgatttgaagcaaaatacacaatggcact

caatcaaacatatctacaatgataaggataatggttactta

hi4103 (3-5)

ctgagttgttaacgcacaacaataccacatgaagaaaggacagactttga

aggaataatcagtgtgaggagagatccatgaacaagtctgaacatgttcc

gcacacgcgtgcgcggcaacaattacgtaatgtatcggcttaaagatatc

ggcctaatttagacatcggattgataacgataatcttaaaaatagcattt

atcgtccaataacgatatggcctccgatatattgtgcatccctacaaatt

attatcatttattactcatgttgctcgggtttgaattgagatcacaatct

tttaatgtttaattgtgcagctttacactgaatgcattaatgcaggctaa

acaaacagtgacaaaaaacacctttaaataatattctaagcaagcattaa

agtaggtcccaccaaaacttttttccgtcaacatgatattttactgggaa

gccaaagttctttcatagacgtgatttaaacggcgtgggaggcaatctgt

ctgcaatcgttataaatgctggattaatctacaagttcgaaaaaagttat

taatctgcgattcacgtgtgttttaaactgtgtgttatgatccgtactgg

tcatggatgaaccgtgatccgttacatccctagtgtttatgtatatatta

ttttatctttgcatcacattactttcaaaaacaaattagcaacaaattag

cacttatgcgaggcgtttctgatgcagcgtctatgggggagaataaattt

aacattctgttttctttctgcatatcagtctcacacttcttaatcctttt

tctgaacatcttgatgacacagttttttttataattgttttagcaaatag

gattgtaaaaaaattatttgttgtacttcattttagtgtgctctgtttac

ccaactatgatgacttttgctactgagaaacccagaaatgtgacacaggt

tcttaattaggacattgtacggcaaaaatctcttgattattatgcttgtt

tgggagtatattgttcataaacatgttggcttagaaaaaaacaactttac

aatttccctcatacttggtacacaatgctactacaaaagagacgagcttt

aaacaggaaaatgactgaaatattttgatcatttgagtgtgatgctaacg

gtctaatccaatttaatgatatacagttgtcagatttattagcctctctt

tttaatttgttctttaattcttttttaaatatttcccaaatgatgtttaa

cagagcaaggactttttcacagcacgtctgataatattttttcttctgga

gaaagtctaacttgttttattttggctagaataaattagggctgtgcaat

taatcgaaaatcccatttcgatcgcttgctgctcttgactgaaggactgc

tgtagctgaagtttatttcttacagtaaagatgctttaagcacagtttgt

tttatatcttattatattgtatttatttctctttcgtttgcagggtggaa

aataagtgtgtatatatgcagttgaagccagaatattagcaacccttccc

cccaatttctgtttaatggaaagaagattttttcttcagaacttatttct

gaacataatagttttaatcactcatttctaataactgatttattttatat

tttttatgatgacaggacattattttactagatatttttcaaaatacaag

cattcagattcaaagtgcgattcaaaggcttaatttgggtaatagggtta

gggtaattaggcaagtccttgtataacagtggtttttgttctgcagacaa

tcaaaaaatatattgcttaagggggctaataatattgaccttaaaatgag

tttcaaaatatttaaacctgcttttattctagccaaaataaaataaataa

gcctttctccagaagaaaaaaatatttgtgaaaatactgtaaaaattctt

ctgttaaacataatttgggaaatatttattttaaaaaaattctcaaaagc

gctaataattttgacttcacctgataatcgttttgaataatcgtgattac

aattatgatcaaaataatcatgattatgatttttcccaaaattgagcagc

cctagaataaatacagttttttaattttttagaactcgttataaggacaa

tattattagccccttaaagctatatatttttttgatagtctacagaacaa

actatcgttatacaataacttgcctaataaccccaacctgcccctagtta

agcctttaaattttactttaaggtgtgtagaagtgtcttgaaaaatatct

agtcaaatattatttactgtcatcatggcaaagataaaattaatcagttg

ttagaaatgagtttttaaaagtattatgtttagaatgttttgaagaaatc

ttctctctgttaaacagaaattgggaaaaaaataaacagtggggctaata

agtcagcggggcttataattctgacttcaactgtatgctaaactaagcta

aaagtgctcccgccagacctgtaaattggcttaatgaattcaaatatggt

aaaactcaactgtttaacttttgggtacttgtaacatgagtttatttcca

aaaaagaatgttcttttaattttatttaacatgtaagtgaaaatacctca

gaatctggagctcttgcaaaaaaaaaaaaaaaaattatgtattaatttct

tgatttaagattcctgttttttttttttttttgcctcacaaagGAATCAC

TTTTACCAGTTTGGAGAGATTCGGACCATCACTATcGTCCAGAGGCAGCA

GTGTGCTTTTATTCAGTTTGCCACTCGACAGGCTGCAGAAACAGCTGCGG

AGAAaTCCTTCAATAAACTCATCATCAATGGACGTCGTCTTAATGTTAAA

TGGGGCAGgtcagtgaaggatcacactgtaaaccttgttgtttaggcagt

cctatttttgtgatgtcagagttgtaatattgctctatgtttttcagGTC

CCAGGCGGCACGAGGGAAAGGAGAGAAGGACGGGGTGACGGAGAGTGGCA

TCAGACTGGAGCCGGTGCCAGGGCTTCCTGGTG