cleavage and polyadenylation specificity factor, 160 kDa subunit

cDNA: Genbank AY648797

 

hi2675 is in the 2nd (1st coding) exon

 

gccgcacttctagcgcgagtcgttctgGGATGTGTAATGAATGAGAAAGT

GCTGTCCAGTGTGCTGATAATGTGCACTTTTTAATGTCTGCATTCATGAG

ACCCAGTGGCCAAAGAGCATAACAATCGTACACTTATTCTGTGgtatgtt

cgagtttatttatgcgtatcttcacttacttttgttattgtcaaatatag

ctagctagcatattagcgtgaggtgcaaataatatcaacaacatgttcga

atagacaagggaaaccaataactctctacaataaatcagtaaatatgtgt

ttatcagttatggagcagttagaagatgtgaagtgctgctgtggagtttg

tgaagagtcagacatgacgcatgaagcactacgttagtgttgactgtgtg

tttggttcataagGTGCTGAGAGGAGCCGCTGATCTTCATCATGTACGCG

GTGTACCGTCAGGCTCACCCGCCCACCGCAGTGGAGTTTGCCGTTTACTG

CAACTTCATCTCCAGCCAAGAGAAAAACTTG

hi2675 (5-3)

GTGGTGGCAGGAACATCTCAGCTGTACGTCTACAGGATCATTTATGATGT

GGAGgtgaggatggagaatgacggattcagt