phosphoribosylaminoimidazole carboxylase, phosphoribosylaminoimidazole succinocarboxamide synthetase

cDNA: Genbank NM_199537

 

hi2688 is in the 5' UTR

 

gcattactctgattggtttttatgaatcggcagagtgtcgtaacgcttta

ctctcgtgaaaataaatgagttgagtctcacccctcacccttCTTCTTCG

TCGAACTTTATAATAAGCCTTCATCTCAAGCACAGCGCGCGTGTCTTAAA

CCCGAGCACACCGAATAAAGTTCCTCATCATTTATTTTATTTTGCAGGAA

AAACAAATCCCAG

hi2688 (5-3)

CAAGAATGTCTACTGCAACAGgtaagttagagtttattcttctgctcgat

tgtttctgtgtgcaccatgtttagatccgtgcagttgcgcagtgaatata

aaatgttcccatgtggcacgattcattgttcggttcttatgttttatggt

agattcgtaaatcacaatagttaataatactagatatactattatggtag

caattattatatggtagtgtaattagctatgtaagatgagtcattctgag

cccaaataaataaatttttgtgtaaataaatctgttcttggacgtaaaga

aagaaaaattcttggaaatgtagcccttgtttgtttttgttttttcatct

tcttctaaaaaaatattatgaattaaaatgtaattgctttaacccattac

ctgctccatcaagaaaaaaaaattggattgcattaacacctaatgtcact

aggtaacacactcagtgcatttttaccccaacatatcccataatttctaa

acaatcaacctctactaaatggttgatatgttggtatatggtaaaggtac

tggaattaatccatattttatgaaaaaaattgaaaatataaagtttaaga

ccaagtt