carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase

cDNA: Genbank AY751464               

 

hi2694 is in the 1st exon

 

agatcttcctcctcctccgtgacgtgctcctgacgcacagcttttgacgc

tcgtataaaagcagccggagtgctcgcgcacggctccacgctactgttgc

tggagcagagcgtggacttttttttccattgacccggaccactttttgat

tttaaccacctcaaaacatcaataacgaccaatgagCTTTTTCTACATCA

GGGACAGCATGCTATTTGGCCTAGATAACAACAACAACATCTAAAGGCGC

ATTTATTTACTCCGCATCCGGGTGAACATCACCTTGCGCGGCGTGCTTTT

CACGTGGGCAAACTTCGGCGATAAGGGAGAAACAGAAGTCATTCAGTTCG

ACTCGATTATACTTTTTGTTAACGCTAGATATTCGCTTAGTGTTTAGAAA

TACGAACAGTTTAGTCATGTCGCTGAAAATGGCATCTTTAGTGCTGGAG

hi2694 (5-3)

GACGGGACGACATTTAAAGGCCGTCTGTTCGGTGCCGTATCTTCAGTGTC

TGGTGAAGTTGgtaagtgaaaattaagaagcactggcatgaaatgtgtcc

cagtcagcacctctccgaatggtacacttgttctgttctgtcctcttccc

ggaatgcgtga