cyclin A2

cDNA: Genbank AF234784

 

hi2696 and hi3594a are both in the 2nd (1st coding) exon

 

cccctgatgacgttgccagtagccgcattctgattggctcgtttcaatag

tcgcgggctacttgaactgagagatagtcacaatatcaaactaggcagct

GTAAAAAGCAACAAGGCGCCGTTTGACTCCACAGAATCGGCTTTTGTACG

CGGTCCGAGACCTGTTCACGGGTTCTGCACACAGGCATGGCGCGTTTTCT

GTAGCGTGATTTATTTTTGAATGTCGATTTTGTAAAACGCCACCGGCGAC

TGTTTATATTGTGTTTTTGTCCGGATTTCAACAGCTCACCCCTGTGGCTT

TCTCTGgttagcgtgctaatccatgctttctttgtgcgtaaacatcgtaa

acaacatcacgactcgattttaagccctttgtttggtcttgcagGGCGTT

TTGAGCTGTTTTGCTGCTGGAAGGATGTCAACACAAGGAAGCGCGGTTCA

TGACTCCGATATTCACAATCAGGAAAACATGCTTTCGAGGCTACGCGGTG

CTGCTGCAAAGAACAGGGTTGAAAATCGTGAAAATGTCAATCCTAACCC

hi3594a (5-3)

TAAAGCAGCTAACAACAGGACAGTCCTGGGCG

hi2696 (3-5)

AGCTGGAGAACAACCAGAGGAGACAGCTCGGTCTGCGAGGCGCTAAACAG

gtttgcacgcacaccacatgatcctgaaatgtgctttatatatagaccga

tttcggctgtatgagtctatcatgcatgataatgcagattaataatattc

agcgtaataatcagccccgtttaaaagcaattgctgactgcatggtgatg

tttatgtaaactgaaagctgctttagtgcaatccagttaagattctgcta

tgatttctatttttaatcccgagtatgaaccataatctagttccctgttg

tttcccccccgtttttgggtgaatcctgtatttctggcgccagtggttga

aatgaaagcgatattaaatgcctgcagctccttccctcccaacgctcaga

ccgccattttacaaaccctttcactcactcaccgcagctcaaaccgggtt

gacgtctcttaaagcggtagttcattattaaatcaaaagttttgactcca

atatagctggtttgtatcagtctacaagtttattgtaaagtaatatgtat

ttcttatgaactgcctgtgagtgaatgtatgaaatatgacttttgcacta

ttgcacctgttgcaatatactagggactttttttattgttcaaagctaat

tttgtaattcaactattttatagttagtatggaagattagttgatcaatg

taatttcctagatgtcacaatatgggaagcatagattaaaagattgtgtt

catatttattcatgtgtcactatcatacacacacatgtatgaatctgtgc

acctgatagccatgggttactttggaatttaattttaatattcatatatt

tgttttcagataagattttgcttaatggactaatgaaatcataatcaaac

attaataaatcgtta