polymerase (RNA) II (DNA directed) polypeptide D

cDNA: Genbank AY648795

 

hi2718b is in the 1st intron

 

tcgagcctcggctgggtcagttgacatttctgtgcggagtttggcgtgtg

tttcctccaggtgctccggaggtgcaaacacatgggctataggagaactg

atgaactaaactggccgtatgtgtgtgaatgggtgtttcccagtaatgat

ttgcagttgtaagggcatccgctgcgtaaaacatatgctggataagttgg

cggttcattccgctgtgacgacccctgataaataaagggattaagccgaa

tagaaaacgaatgaatgaatgaaatgtagtacacaagatggcgctgtgtg

tgaatcctctcatgcttctccactgtagtagaccagcaccggaagtagaa

tgtgttttcgTTCAGACTGCGCGCACTGGAGTTATGCGGCTGTATGAAGC

GAATAAACCGTGTATTTACAGTCTGTAGTTTGATTATATGAATCTTGTGA

TGGCGGCGGCAGGAGCAACGCAAGTGGGAGATGTGGAGGAGGACGCGTCC

CAGCTCATGTTTCCTAAAGgtgaggggtttattcacattac

hi2718b (5-3)

aaacaaacaacacgcgccgttatgctacacacatgattctgtttgattcg

gtgtatatcgtacacccataatttcttctccgaattaaaattacagtgat

atatgatcatagttcgttgtgttttgttggcaaaactgtcagcattac

 

approx 1.9 kb to next exon