ubiquitin-like, containing PHD and RING finger domains, 1,

cDNA: Genbank AY648713

 

hi272 and hi3020 are both in the first intron, before the ATG

 

agggcacgcgtggtcgacggcgacgagtcgatgaaaaccccaaaacaaca

tgtctatagctcaaagaaaaatccccacaaaccttttggacaattagaga

attcacatcagaccagaaagatttaacaaagggacacaacaaagttaatt

tatacactccacataataaagtcgacatttgtaagtgcgctcttattata

taatcctcatctcccgccaaattgcgcgagagtaagccagcatggctagg

gtttcgcgcgcaaccctaagctccggtaagcagcgtaaatgacacgccgc

tcagccaatcagcgagcacatttgaactccccccagccaatcagcttgcg

ccgtgcccacggcaggaggggaaacacgttgttcaacacttttattgatt

cgagctcgtttcattgcgtttCGCGGCAGGACTGAACTCTAACAAAAGTG

CTGCGTTTTCACACTTTCATCACATTCACTGAATCAAAATCACCTCTTCT

GTTCCCGAGAAGAAGATAACAGgtaaagagctgattttaaattcactttc

ggttgatatttgaatgtattgttgataaaaccgcgcgcacgagctgcatt

ttactcaataaatattagcaatttgcatatttatctcctgcatgttaatg

tttacaatatgtaacgcatcttttattcgtctgtcttgcaaaaagtttag

agtttgaactagttataagccttaagtcttaaatgaagtgtaaatctctg

acttgtgattgttatttgtattttagtcaataattcagtcaaaatgttgc

ttattaatgttgtatacgctaaaataagtaatcat

hi272 (5-3)

aacaatgctaagcagcataggaaagtgt

hi3020 (5-3)

ttgtgaaggtcgaacttgagtgattcagtattcagtaatggtggatactg

atatacagttggttaatgtacatttaaaatgataaatgcttccaaaatgg

acaaacctttactgattctgacttattttctaacatatgtgtctgttttt

gatgcaagaccacccacgtcatgaccaacactcaacccttcatttaagtg

aacgcagtttgcgttggttcccgtttaaacgggttggtttctgcaaatga

acaccatccaagctcgtatctggagctcaggcctcattcctgcttcctgt

tgttggtttaaagtcgacatgatgaagactgatactattcaccccctgca

gtaccgtgactcacaccagggggcgtttcttttcggtttccgccaataac

aggcgtggtttgttgagctaagatgtcaacaaggctcttcatgcacttgt

aggaatggaggatctcagatcttgtagggcattggcctacctttttagtg

atgtagtcatttggtgccaagatgcattcataatccaagttccaacattg

gtgggaaaccctaaagagtaagccattttaaaatgatgactaatatatgg

aagaaattagtgatttagggctttactcaaagtacattggaattttttta

gttaaatagggaacttgtaccatgcagaagccattttgtaatgggaagaa

gtctctatatatgggttcaaagtaggtctgcacaatatagaaaaaatctg

caatattttggttttctgtgatatgaatacaatttcatcagatagcttaa

atagctatttgttataggcatggtccggtataagattctgacggtatgat

aaccttgaaataaaataccacggtttcacgatattgtgattgctgcttta

aaatatattatttttgaatgtctgggtaaaaaaacaaaaaacacaactct

tccacctttgaacacgatatatttgattttaagaaacatttaaaatttta

aagcagtaaatatgtcaggttacgtaaacgaattaaaacactgatttatt

tacaatttaatacagtatctttggatatctttactgcaggagatactgtt

gtcctaaaaacaaacaaaaaaaagttgataaatcgtacacataccttaga

aatggtataatagaaatattggcggttttaaaacgttgacttttccaaac

cacggtataccttgaaatggttatcatcctagccttatttgggaagagtc

taagtataggaattaaataatcaaatataaaatagcattgcacagtcttt

aatgtacaaataattcaatacaattttttttttttattaaacttacaaga

tttacaattccctgtgcctgaaagccatacactttcttgatctggtcata

cagtcacagggcttaaaaacgcatgcaaatgctgaacttttgctccatta

tttatggtaaaaattacttcgcttgttggtaacactttatcgtccccaat

gggtaggcccactctgaatctgcgcagaattctgcagtttttaagcccat

cattaattctgtttatttacttaagtaaatgagtgtaaatctatatttat

tcagtatttcaattaattacagtaatattttggactaatgtgaaaatgtt

catctgatttatgtacaatacagtttgtaaagtaatattttctgtctttt

tgtagatgtattgtacgataaacttgctttgtttaccaaataaagtgaat

ctgatttgcattgtaaacattaattagatacaagttacaaatatatatat

tttttatttcacatattaaggttttagttatgataatctcaaaatctttc

cgcagaaatccacagattttttaccaaaattttgcgcagaaatcgcaaaa

aatgtccgcagattccgtctggccctaccaatggggaaatttgtcttgga

ctctaggcccacatttacattcgctgaacagaaacgcattaaaaaacata

aatcaacacaaacattcaatcatcagcaaatattacatatttaaaagtct

aattgatgtaagaaaaaactaaagatatctctcaaatcttaaatgttctg

aactgcgcctcctggtcaactataattacaattcaattagagatccagct

acgtgactattgcgaatgtattttgtgatatcgatgcaaaaacgatataa

tgtgcagctctttttcaaagcatcaggcttaaaaactaccactggaaatg

aacgagcaaaaaatataaaggtatctaaacaaccttttgtttacttatct

caaaaggctgtaaaatgtcctaataatcaaatttgagtcgcactacagtt

tgagcttgtgaaattctgcctcgagctgctttgaaaagggatgagaccaa

aagagattagacattaataaagcaagcgattgctttaaatttaacatttc

tgtacagaggggtcatgttttggtctttaattggtctcaagcgttcatgt

gggcctgaaattgcagttctgttcaccgaacttgaactttcgaatgcagc

gagacttgtcacaaaaggtgctttcacatctgtagttcgcttcatttggt

ccgcaccaagggtaagaaatgatacattgttgcatcttctgccgtctttg

ggtagttttcactccacaatgctggctttggtccgaaccagttgaaacga

accaaaatgcagtcatctgacaaaatccacatctctcattggccagatgt

tgttgaacatatttccttaactgcttactgattggtcagaattcacgtgt

gggaaaatgcatgtgaactcccgcaggtaaacaaaaccggcagacacaaa

atgttttaactatgaagggacgactgcactgactgattgtatgcctgttt

tagacaaactatacatttcgagaatgaagcgcggctggaaaacagtgtct

aatgcatcgctcgtcatttcaggaggagacgtgaataatttagctaaact

gcgacatggtcatcttgcggaaatattaccaatgatccatcaggtaatgt

tttcctctctctctctctgttggtaaagcgctgtcaacaaatatttttcc

tccatatcccataatgcacagcgcatcggcccacggcagctgaattagtc

caaaagccgcagtactttttgcggttggacctgttttagtacggatcata

ttctctagcgttttcattctgctttgtttgtatgcaaataaattgaagtc

tttgaggttaaaagtgcagtgtgacctccgatttactcatgtagactggt

tttacattgcttggccaagctgtacgatttggttttctgtaaataaaaaa

aaagttattcatttatgaatcatcgatgggttggtttatggtaacccatt

tacctcggggaatgttatcatatttgagcatttaataccctcttttacat

cagtagtctttgaaatgcagttgtttctcaatattattatgatcatttga

tgcaaggctgcacgatactggaaaaatatgctgtttaatgtgtttttcct

tcaagatagctaacttgctaaaagctgcttttattagcaatacaaaatca

cttatgtaatgatcatactaaaattaaatacaattaaataataaaaaaaa

aagctgtcaaggtacaaacatttggactttaaaatgaccacgaataacaa

agcatctgaggaaattcagattcttattagctgtcgtcattttcctctct

cgtctcctataattgtttattttcagctctgtttttacctaacagcacct

actggaggggcggaataaagatagtaacgattgttctgattggtcaggtt

tggattaattataacgcacataaaatttacttcatcaatggtgaatattt

tatcgtcataacgttttttttccccagatatatcgtgctgccctattggt

gcctggcataagcataatccggtttacacattactataaaaccttcaggt

aaataaatggtgcttataactagagcaggcaaaactcctcttactataaa

acacattttactggactgtcctacttttactgatttcagaagactttttt

tatgaaatgaactcttttaaggacatttttgacaaagtgaaaccagaaga

ttttagaattttattatgcattaacacaaaaaatctcaattaatttatgt

tttattttgtttgttgattttttttaaaattgtatatttgttgttgaaag

attcctgccctgaaaatagccttggttgctgacatggcatcaaatacaaa

atacattacattacattacattacattataactagagctgcgcaatatat

catttcatctgcaagagtcacatcgtaaatatgtaaagttgagtcttgtt

tctagttgaccaggagctacagaattgtatttgattactgaataggaaat

ttgtagggtttatgccaaaaaaaaaaaaagtttagtcttgtttttagtcc

aaatatctacatttcaaagcaaaacaagattattttgattgtcacactgg

cagataatttagcttgttttaagaaaaaaactcttagttttgctttattg

ttttgtttttatctttacaagaaataattttacgcaagtaaaatttataa

aaaaaaagttataagtattatttgactagaatgagaatcattgcaattat

taaattgttttgtacttgaaaactgttaaactcccccaaaaaacgtcaaa

tagagctattcacacgtcttgtgaaactatatgcatatcgcaatgttaat

cacagaaaaataaaattgcaatattagatttttttaatatcatgcagccc

tatttgtaacttaaagtacatttgagttttcaccgttcaatggccgccct

gtatcatgccaccatctttttgtaatggtaacatgactctaaacgaggtt

gcaaagaagcagagaaacagaaaagcgccgcaggagacgaatgtggaaaa

aaaacaacccgactctgaaaccaacacctttttcctgctcgtataaaggt

tttggctcagagccattgtctgaactgtaaaataaaaaggcgggaaactc

actctctggtgctcttgtttccagGTTTGCCGCCATGTGGATTCAGGTGC

GCACTATGGATGGTAAGGAGACCCATCGGGTCGACTCCCTGTCCAAGCTC

ACCAAGGTGGACGAGCTGCGTGTGAAGATCGCCGAACTCTTCAACGTCGA

ACCCGAGCGGCAGAGACTCTTTTACAGGGGCAAACAGgtgacgtgtggtg

tatttgagagctgttgcgtaaagctagtcgactcgtcgcctcg