hepatocellular carcinoma-associated antigen 127-like (zgc:63849)

cDNA: Genbank AY648796

 

hi2729b is in the 1st exon

 

tcgagaaaaagttgcctatatacctgctctacataaacattaacaaatta

ataaatgttcttgtttttctagatatgtttttgtttgtttgttttatgat

aaacatgtcatacaaataaagctggctaatatttaaaatattttacccca

aatatcctttaaatctatataatctgaatatcacggacgtctgacaaaac

ccttgagtgattttttaaacgcgcgctccctttaaacctcgccgagaatt

gtgggaaatGTAGTCAGCGGGTGTTGCTGTTGTCCACAGCTGGTTAGCAT

TTCCATTGTCTTTCTTATGAGAGGAATATCCGCTACAATCGTCTCTTCTT

TTCTTATTCCAACACACGTCTTACCCTTTCTTAGTCCACCATGGCGGACG

AGCAAGAGATAATGTGCAAGC

hi2729b (5-3)

TAGAAAACATCAAAGAAATAAGgtaagaaaagccgagattgcttcaaaag

cagacacgctagctcagtgtccaacatctggccaattcgcctggatcgct

ataaaaacgcataaatataaacgtttaatttctttgaagcagtgcttgat

ttgcctgtttaatcaaccattaaacaatttgagatattgcttcattgctt

tgtgtcggtcatcatgctaaagtaaatagcttacaacataaaacagaagt

agctttgctctaaatctgaaaacgtctcgcactaattctgcaaagtctct

gatcacaccgttattttagcgttagtaagtgtgtaggcatcctgttgtgg

ttaggaacgaaactgcatagcaaacggttcatttcctgcacaacggagct

taatcatttataaagcctttaatgatcgtctgctgaagtattgatgtgca

caaaataggcctaaaacattttgtgatggcatcactgaaaccacaataca

gatgtcttattcatttaaagtcacatgcaccagatcagatcaggctgcat

tgttatagcattgtcatgcagtggctggatgctcagtttaatttgtgtgg

gtttacagGAATAAGACAATTCAGATGGAGAAGATCAAATCTAGACTGAG

GACCGAGTTTGAAGCTCTGGAGTCAGAAGAAAAGCACCTGAGAGAGTACA

AACAGGAAATGGATCTTCTGCTGCAAGAGAAAATGGCTCACGTAGAGGAG

CTGCGGCTCATTCATGCGGATATTAACGTGgtaaacagatcatctgtgat

acaagatttgatttgaactccatttataatttctttattgtttattcatc

acatctg