cyclin B1

cDNA: Genbank AB040435

 

hi2734 is in the 1st intron

 

cgctataattttcgaacccagcgaatcatatttgaaagagcgacaattTA

AACCTCTGTAGAGAAATAGTGCTATATTGAGCTCGCTTGAGTAGATTTTA

CCAGTTTGTTCATCGAGTCACAGCAATAAACCACGAGAAATGATGGCTCT

CCGTGTCACAAGGgtaagttgttttattagcatttcagttttaagtctgc

gtatgttgcgttgtacagagcagcctttgttcattattcatct

hi2734 (3-5)

gaaggagaatgccagagatgttccattatcgatgtctaacatggtgctgt

gttagcgcgttcttcagttcctataatttgcgaaagcattttgtagaaag

tttcattttagagatcgtgttttatttgtcactgttgcattttaactttt

ttttaatgtgctgtttataagactattaatcgcatgctttaagtttacga

tgaactatattgcatgatgtctatagattttagttgaaagctctctaacc

taactgtttaagccaccacttaccatttctgtaaaactgattattttatc

caccctaccgagtagAACACTCGCCTGGCCAGCAGCGAGAATCAGAACGC

TCTGCCCGGAAAAGCAGTTGTAGCGAACAAGCCCGGACTCATACCAAGGG

CCGCGCTGGGGGAGATTGGCAACAATCCGCAAACACGACAGGCTTTGAAG

AAGAAGgtaagagcttaaagtaatttcttcatttatccccttgtaatatt

gacaagttttcaatttaaaaataaatcgccaaacttgtaacagGAGGTGA

AGGTTGCACCCGCCGCCGAGGTTGTGGTTGAGAAGGCACCTGTGGTTCAA

CAGCCCAAGAAGGATTCTCCTAAGGTTCAACATGGCGTTAAGgtaaaccg

tggatctgttacttttaaaattgataaagtttagaagggtacacgtacaa

agcatctgaagattactgttgcatgatttctgccgcagttgttattactg

tatgacggtggactaggttttattcaaggggcaggttttttttttttttt

ttttttaaaccatcaacgttaaattgccaattttaataagcgcgcaaact

tccggctgaataattttaaacagggcgtttcaccaacctaacgttagcca

ggttagaaagcggtgaacatcaggcccctagtcagcctagtgtaaggggt

gggagaaaagtcttttcaatgttaaaaaaaagcgatgcaagaattttttt

ttttttcttttaactcctttgaataggcttttgctgttaaaccagatcac

attttagagtttagcatacctttttatttaatcttaattgtagtactttt

tccccatataatagaaactttcatggtgttaatcacaaacattttgtgca

actgtttgcatttaccaaaactggttcttaagtcggggacctgaatgatg

caagtgtagctttctgttagactggtgatttcagcctgcag