MGC10433-like

cDNA: Genbank AY648798

 

hi2735a is in the 1st intron, before the ATG

 

ctactctcaatcagttgtatcaaaaaactaaatgtaagaatttgtttgtt

tatttatttaatttctaatataagacctacagggaaatctttctaaataa

tgtttagcttcacaatcttttcctcaatattttattttattatttttttt

tcatttatttatttatttatttatttatatatttttctcaatattttaag

caagtgcaaggaagtttagggtcctgatgtcatttttctgcgcgatGCGT

CGAGGACGGGTCAAATGACGCATGTGACGTAATTGTTCTGCGTCCATACT

ATACGAGCGGTATCGTTGAAGAAAACAAATGATCCAGATTCGCTTATTTG

TCAAATAATTTTATTCCCCCACATATATAGTTGAATTTCTTCATCTGGAC

GGATTTCTCTGCGGgtatgtatatagttattgatcacttagtgttttggg

cgctttagataaggtttaatgcagcccggagcgtaaaaactgaatcatgt

tccttattaacatcatttcccagtgttttactaataattaatcgaataaa

acaggatttggttaattacagattttaaaaatcagttttttattgatgtg

ttatgctacaga

hi2735a (5-3)

tacattggttttgtctcaaaacgtagttaagtgtctacttagtgcatact

tacaaggtgtgcagcatgttttggtttgggttaatattcacattttaaaa

ggtaaatatcgtaagattctgctttattttgtgcataaaaagtgctgtta

agacaaaatataccataaaaatagttatatttgttcaatactcaaccatt

cgttgatgtatttaacatttaaaacagcagttccttgatatgtttacaga

gacttcatgtatttgtcattttatttctgttcagAAAACACTCAGCATGG

CATTAAAATCAGGAGAGGAGCGCCTGAAGGAGATGGAGGCAGAGATGGCA

CTgtgagttcttgacattgcattcatgtgtaacgttagttccagcagatt

aaatgtggtgtaaatgatgctttcagtcgggatagtttcggaatatagta

taacatttccagactgtatttttctacttattttccttgttttgtagCTT

CGAGCAGGAGGTGTTGGGTGGACCTGTGGCACCTACTGTGGTTGAAGCAG

TGCCGGTTGCTCTAGCAATGCCAACTTTACCCATGGTCAGGCCCATCATT

GGCACAAACACCTATCGAGAGgtattcattacaactattttacataacca

atatttcacatggtgtatttctatatgctggctt