selenoprotein H-like protein

cDNA: Genbank AY216587

 

hi2737 is in the 3' UTR

 

GCAATGGCGACTCGAGGCAAGTCAGCTCGCAAGCGAAAGGCGGATTCAGA

CGAAAAAGAAAAGCTTGACGATGCCAAGAAAGAAAAGCTTGAGGATAAGG

ATGAAGAAACAGGACTGAGGGTGGTCATCGAGCATTGTAAGAGCTGGCGG

GTTTACGGGCGCAACGCGGTCGTCGTGCGGGAAGCTCTTGCAGATTCGCA

CTCTGAACTCAAAGTGATGATAAACCCGCACAATCCCCGGAGAAACAGCT

TTGAAATCACGCTGATGGACGGAGAAAGAGCGGATGTTTTGTGGTCCGGC

ATTAAAAAGGGTCCTCCACGCAAACTCAAGTTCCCTGAGCCTGCTGAAGT

GGTGACCGCCCTGAAACAAGCGCTGGAGAAAGAGTAAATACTGTCTGCTT

TCTGTGCTCCTGGACACTGGATGCATTTATGATGTGAATGGACTAATGGG

AAAATCTCCCCGTCTGTTTACTGATGACCGACTCTGCTGTTCTGGACTGG

AATGCCGACTTTGCCTCGTTTCCTCTGTTAACCATTGTTCAGTTCTGCTG

TCACATGATTAGTGTTAATTTGCCTTTATATGTCTTGTGTCTAGTGTTTG

TG

hi (3-5)

ATACTGTCTGCTTTCTGTGCTCCTGGACACTGGATGCATTTATGATGTGA

ATGGACTAATGGGAAAATCTCCCCGTCTGTTTACTGATGACCGACTCTGC

TGTTCTGGACTGGAATGCCGACTTTGCCTCGTTTCCTCTGTTAACCATTG

TTCAGTTCTGCTGTCACATGATTAGTGTTAATTTGCCTTTATATGTCTTG

TGTCTAGTGTTTGTGTCATTCACCTTTTAACTGTTTGAATGGCACAAATA

AAGCAACTATTTCTTGAAAAAAggctgactttgacttctgttaagctgct

aaactgttaaactgctcatttctgatttcacatgactatttgtcattcag

ttttagctgtttgcatggccccaaacaagcaaatacttctggggtgaaaa

ataaaatcagtgcatgcattaattacagagaacagggtagcgatagtgaa

atgatgtagtcacagtgaaatcatgcatattttgagttggttttgaggat

atttaactctctggtcacatgctttagagtagattgataggcaacataat

ggtctttaaagggaaaaccctcttaattttaagatgcatgcaaattattt

aatttatttaatgtattttttcatacttagaagattaaaccataagtcat

tgttaagtttttattttcagaatatataatttctcatgttatttttttct

atctccttttttggtttttattttattccaccaggtggcggtaaaactat

ggaatccaaatttaaatgccacattttgaagtcagaattattagctctgt

ttattttttcttccaatttctgtttaatggagagcagatttatttaacac

atttctgaacataatagtttagtaactaatttctaatatctgatttattt

tatctttgcgatgatgacagtaaataatatttgactagataatttttcaa

gacacttctatacagcttaaagtgacatttaaaggcttaactaggttaat

taggttaactaggcaggttagggcaattaggcaagatattttataacaat

ggtttgttctgtagactaacaaaaatagcttaaaggggctaatattgaac

ttaatatggtttttaaaaacttaaaaactgcttttattctagccgaaata

aaacaaataggactttctctagaagaaaaatattatcagacatactatga

aaattgctctattaaacatcatttatgaaatatttaaaggaggtttaata

attctgatttcaatatctataatgcaagagagaatctgacaatgacaaat

gtctcattttaccagtagaataaaaatggtctaatgttgtcaatgacaga

ttacaaacatatatcttaaacataatataaacatagagctacgcatcga