zgc:56708 (cell division cycle associated 1-like)

cDNA: Genbank BC050181               

 

hi2769 is at the splice donor of the 1st the exon

 

aatatttattttaattaagttaaattttttaaattttaataccaatagtc

aaatacttattctaatagatttgattgcacactatgcacactataccgcg

tgtattgtttattcatgttggagcataaactgtccagtagaggccgccgc

gcattgcttctgtgatgacacgtgatgtagcggaagtgacgtcaaaggag

gcgcctaaagtttaaaatttgcttcagttgacggcgagggacgttgttgt

gaacttggctggtgaataaattttgtatttattgtgtatttttagttatg

gcggccaggcaatgtgaaaaagacggtaatataattatgtatctgtgatt

tcccgctgtcggagctttgaatgttgcctttgtgttactttaatgctgtt

GTTGTTGTTATGAGGGCGGTCTGTGTTGTGCCAGTAAACAGTGAAGTGTC

GCTCAGTACTTCATTACAGTCATTTGTTTCTCTTGAGCAGCAGACATGTC

TGAAAACACGTTCCCGGTGTACAAAGTGGATGTTATAGTGCAGTTTTACC

GAACTGAGGTTTTGACTGGACAAGAGTCTAAACATTTCACCAAGAATGAC

CTCACTCCGACTCCTAAGgtat

hi2769 (3-5)

tattcctctgtgttattctcatctctcactcaagtgtgtacaataatgtc

aatttaaactagcattgggttttagttttttgtggggtttggttgtgatt

ctctacaaaacttaggactaactggtcttaaatcaaagcagaaagtcata

catttattgcacatgaaatatactatatatagggttaaactgcactgtag

taatgtgtctaaatattacagtattaacaactctgttaataaatgttcct

gcatactgcaatgttagcaataactatagtgaactgacaaactaattaga

aatactgtagtttaatttagtttttaatactgttatctgctgtaatagac

tcttgtagtaagctatagtattgggaaacttgtgtatatattactgtctt

tgttgtgctgacttattaatgcaagtacttgatatagtatggtttgaaaa

cgctgtagtgtttactatgaattactacagcatttagaagtgggattact

catggcatgtactgcaaaaataaatatcttcatttgttttatttgctatt

taaattaattcattatattaagataggtttacttgagattatcaacaaat

tgaaaataaatatccttcatagtctgcttgatttgaattaagacattttt

tctgcgccctctggcagataatatacagctgaaggcagaattattagccc

ccttcaattttttttatttaaatttttttttcttcttttctaaatatttt

ccaaatgatgtttaacagagcaaggacattttcacagtatgtctgataat

attttttcttctggagaaaggcttattagttttatttcggctagaataaa

agcagtttttaattttttattaaccattttagggacaaaattatcagccc

ctttaagctgtatattttctcga

 

approx 1.2 kb to next exon