histone deacetylase 3

cDNA: Genbank BC044543

 

hi2786a is in the 1st intron

 

GAAGAAGAAGCGGAAGTGATTTTTTTTTGCTGTTTTAGAGAAGATGGCGG

CGGCGTTGAACAGAAATTAGAATAATTAAAACATTTTTGTTTTCTCGTGC

TAGAAATAACTGCTTTTATTCACACTCTGTAGCAACATGACCAATCGAAC

TGCGTACTTCTACGACCCAGACGTGGGGAACTTTCACTATGgtaagattt

taacgtttcgtatagcataggttgctaatggatgataacgtttaaattac

tgtttactcctgtatgcggcgatgcccagataaaaaaatgatttaaaaat

gttgtaagaactacagtattttagaaacatactatagtaaagttactgta

aatatcggcctatatttacaacacttgttaatgaattctactgcgggctg

taatactgtactatattttaggtgtttacaacaataaactatgctctatt

atagtatagtttacgctgtaacttagttgtggagaatagtgtaagtggtt

ctactatgtgtctatacttgtattacaaaagctactgtagaattaccccg

atagattaattcaagtgttaaagt

hi2786a (3-5)

tttactttaattattgaataaaatgcattattattattattattattatt

aataataataataataataataatattgttgttaaattaactataattag

tttgcccagctatagctgtttacatcaacattgcctaaccgatacattca

gacttcagcactacaaacaaaaatagagtactcaagaatagaagattgca

agatgaacattttgatctatatttacaattttacatgaatcagcgtactt

gactgttgaataaaactaaatacataacaaat

 

approx 8.6 kb to next exon