FLJ20195-like (AK025355-like)

cDNA: Genbank AY648800

 

hi2786b is in the 2nd exon

 

gtcccattataaaaaggaaatccgcaaataaaatcagtaaaactgtgact

tttacattgaaaatcaacagccttcagttttagcctaatgtctacagtca

tcttgcttgttgcactctgcaaactttcctaagtcattctccacttagtg

tatgaataaagctttatgcgtgtttgtgttctcgtgttccagcgttttta

aatagtccatccactttcacgttgttttattaccgatttcaacccatacg

tttcaaccgcactgttgtccgctccagtccagcaggtggcagaagataac

tatttagcCTACAACAAACATGGCGACTCCCACAGAACACGAGGATTTAT

CTGAACAAgtaagtttttgtgttgttttacgatgtcaaacgttgcaggaa

tgaagaacgtgtacacatattttaataaacatttcaaataaatgtttact

tcaaaatatctggaaatgaagtcgcaaaagatacgttaaatcggtaaaga

tgtcatgccaattttaataacgctgaatgcgacactacctggtgttgatg

atattgttttttatcagcagGAGGAGACAG

hi hi2786b (3-5)

AAGATGAATTTAAAACACCAAAGATCCGAGAAACACCAGAAGACATCAAA

CTAGAGGCCATCGTCAACACTATTGCATTTCATCCCAAACAAGACATTCT

TGCAGCAGGAGACATTGATGGCGATATTTACCTgtgagtttgttttctaa

aggcgtctaaagtccttgttcaattggcagaagtagtgtttagggttgaa

gctaatgttatgtgtagaatatttgtagttatgttaaatgtaaactaaca

tttcaatttgttttatatgaaaatttttaagcatgtattagtc