PRP3 pre-mRNA processing factor 3

cDNA: Genbank AY648801

 

hi2791 is in the 1st intron, before the ATG

 

tgaattgaattaagagagagagagagtaaaatagaaccacgtaaaagaaa

tgaaacatgcaaaaataattccttataaagccaattaaaactaacaggtt

tttaaaagtgttttaaatttaaatatgtgtttataaatttatgtacgcat

gcattgtcaagtgacagcaggtggcgatatgcacccagattgcaccacgc

caaaaaaacgaaagaagaagaataataacgtttccgtttccgtttactcg

ttgggaaacgtttagccaacactgggTGCAGTGAAGTCCAGATACATTTT

CTCACTTTGTGTAAATAACTTATTTTATCATCAACGGTTGTTTTGGGTAA

AGAAACAAAATTGGAAAGTTTAAATAACAACGAGAAAGCTTCGTAGATCG

CCGTGAACCATCTGGAGAGTGACAGAGgtgagttttgttt

hi2791 (5-3)

attgggattcagttggtttgcaacggaaacctcttttttaaacaatctaa

taataataatagtaatttacggcaaaatgtttgagttgtaaataatgtta

tattaaagtgttgtagttgtttgtatatactttgtttaaatcaacaactc

ttgaggccaataaatagaggtaaagttggatttatattcggatattgaga

cattctccttaataatttaatgtcagaaaagtattctctgcaaactctaa

atagggaaatcatattagcaccaaatgactattaaagcacaacattgttt

acagtcaattagatagtgttaatgctgtttagaagtcatacttgcaggct

aattccgatcgagtattcaaagtaacatggtaaacaatatagagactgct

aaatgaacaaattgcgaatataaaaccaactttacctctatctaaataag

tgtaacgtaccatgcacacactttgcaggctgaaatctgacattgccata

atttcctattgtgtttattgctatatgaatataatttcaccagattattt

caatagttcttgaaattagattgatcgtctggttcatacggtcatggaaa

acctggaaaagtcatggtattttgacatggcatttttcaggcctgaaaaa

gttttgtaaatacagaaaaacccacaaagtttctgaaaagtcatgcaaat

tagtttaacaaatatctgtatgctctaattagggatagaggtaaagttgg

ttttatattcgaatattcagacattctccataacaatataacttaatttc

agagaagtattctttgcaaattctaaatgaggaaatcatattagcagcaa

atgattatcaaagtacaacattgttgacagttaattagatagtattaatg

ttgtttagaagttatacttgcaggctaattttcatcgaatattcaaagta

acatggtgaacaatatagggacttctaaatgaacaaatgtgcgaatataa

aaccaactttacctttatgaattagggctgtgcgatattggaaaaatcgg

acattaccatattttgtagttctgtgatctatattgcgatatgaatacaa

tttcaccagatgatttaacaggtttatttagattgattgggactgatttt

gttaaggagtgaatctcaaataatatataacaaataaattaaaagcatag

gtacataaaatatagcaaagatgaaagtgaatgaaagtttttaggtattc

actattcaggtacagatactgaataatcaacactgcatagtcttcattgt

atattatttaacctttattaaagaaaaaaaaattattgtggccggatgtt

tcaaaatgtgaaatattgaaatgctcacacttcacacagtcacgggccac

aaagggacagtttactcaaagatgaaaatgaattcactatttactcacat

ttcacttgtttcaatcctataggagttattaaattatattatttttgtgt

ttatttaaaaaaaagaaaactcataaatgaaacaagtgaagggtgtaatg

gaaatggtaatacatttttgggtgaattgtctctgtaaaaatgcatgcag

atgataaactttttaaattatgattaaactattaactatataatctcaac

gttgcatattctgcgatgcgactattgcagatgcacacgttgcgatatcg

atgctgaaacgattgttcgaaacgattgaaacgaaatgttcttgaaagtt

ctggaaaagttttggaaaagtcatggaatatacatacataaaaatatgta

tgaaccctggattgggatgattctgtagggcgttgagtcacacagaaaat

ataataagccaattacaagcataaattaatacaatagcgcaaagataaga

gtgtagtttgcagctttatagttttcagtaggtacaaaaattgaataata

caatgtagtgtgaagcagtactttatagtaatattcattgtataaataat

tcagtaaaacaaagctttattaaagtaaaacatgtactattattatcttt

gcccaaatgttttaaacttccttgaaatccttttaaaatgcatgcaaatt

ataaactgtttgctcactttcctttatggcgttgagtcatacagaaaata

caataaacaaattacaagcataaattaataggataaagtaaagataaaag

tgtggtaagcagtggtttttagttttcaaacagaatttaggaacacaaat

taaataatcaaatgtaatgtgaaatgacactgtatactgtgtatagtcat

cttcattgtattattcattcattttcttgtctgcttagtccctttattaa

tctggcgtcgccacagcggaatgaaccgccaacttatccagcaagttttt

acgcagcgaatgccctttcaaccgcaacccatctctgggaaacattcaca

cacacacactcgtacactacggacaatttagcctacccaattcacctgta

acgcatgtctttggactgtgggggaaaccggagcacccgaaggaaaacca

cgcgaaggcagggagaacatgcaaactccacacagaaacgccaactgagc

cgaggtttgaaccagccacccagcaaccttcttgctgtgaggcgacagca

ctacctactgcgccgctgcctcgcctttcattgtattaatagtttagtaa

aacaaagctttattaaagttaaaaatgtattattattattatctgtgccc

gagtgttttaaactcccttgaaaagccttttaaatgcatgcaaattctaa

actgttcactcactttcactccgttatggcttaactctgcagtgactaat

aacaaatgacaatgacaaattatatgtattttgaactggggtgctggtgt

gataaaatgcaaactcaccatcgtagatcctttgaatgtgactattgcag

attcacacatcatgatatcaatgctgaaatgatattgcactaccctactt

agaaatattataaatactctataagtaattacattgattctgagctatta

tttaattagaaatatttttttgtagcaagtctatccattgaccactggct

gaaatagttgacatgttaaattgcactggaaagaatcacctacattataa

agagcaaattaaatgagtaccataacatttgggatctgtttatacaatat

ttggaacaaaaccatataatggcacaagcaaatacctctcacactactgg

gtaattgattgatatgtgtatttttgtatgtggaatacagtatatgtttt

tatttgccttagcccatgtataacaatacatttacgtgttcaactcaatt

tggatgctttaggggggatagggtgaagagtagaaatgtaaaaaaaaaaa

ttatttaatggtaatggttaaatgtttttttctactgtaaaaaatttttt

ttttttttttttgaatatatattttagtgtattctctgtaatactaatcc

agacataacacaactgatcttggaaatgaagagttcaaggttaaaaagca

gaatttaggatggctgtacttgcacttttttgtcaatattatctggttag

attggagctttcaaaagtgtataatgatgaatctgagcattagttgttat

cacacattacacagttttgttttatttgttttcttcctagATTTTTCTCC

AGGATGTCACTGCCTAAACGTGAGGTTGATGAACTGAGGCCATGGGTGGA

ACGCACAGTAAAGAAGGTCCTTGGCTTCTCTGAACCCACTGTGGTCACAG

CAGCATTGCATTGTGTGGGAAAAGGCTTAGACAAAAGAAAAACCATAGgt

aagatgtttatcttgtatgtaatttaggtttaatggataacagcaggtat

aaattgatgtttactagctcagtatggctagcttaaactagtaacttcac

agatatcagcttaaagtagagatgcttcgatcagcatttttggggctgat

taccaatcaccaaaattatgatctgccaatcacataatggcaagggaatg

ggaatctt