40S ribosomal protein S11

cDNA: Genbank AY648802

 

hi2799 is in the 1st intron

 

aaacgattttaaagttattttattgtaaaggatataagccccgcctacgc

tttgtcgtcatatccgtgaaagactgtcttccgtctgcctcgcgcatgtg

tagtccTCTTTACGACTCGGCTGGCGAAGATGGCGGACACTCAGgtatgt

gactccgaacggcgtggtcgcaaaaaagcgtttgaattaccgtcaaagtt

aaatctaaagccgcacgttatggtggattagcgtgaaattaacgtgcatg

gaggcagtcatggccaaaacggactgtattcgggattataatatgctatt

tctgccccggctagcgtgtgggaagtgttgctgtacgggaacacgagcgg

ccttcctttactacaccagcagaacgtggcttcataaacactttagagtt

acaagcagatactctagcagtgtgtaaatcagcatgggtggttgattcac

tctttgtaagtgataaaccaacagagaccgtagtgtagtcgctccttacc

aaaatgagcaatgaaaatgttctctaataacgctgattg

hi2799 (3-5)

taaaacaaaagcttttattttgtaacgtcattaacccaaaacgcatttct

agattgttttcttaaggattacgtgtgcatttaatacacgtactaaatac

acacgaagctgcaaatgatgttttttctcacgatggtcttccaagtctgt

caggctctgacgacactgccttatggcatcactgatgcagcaaaagtcct

aaaactgttaaactaatgactggaaacgctcgacgttgagtcatcttaag

aagatgacagaagaggcttttatttttattactcaagaattgtgactgac

tctgtgcttgtgcttaatttcagAACGAGAGGGCTTATCAGAAACAGCCC

ACCATCTTCCAGAACAAAAAGCGGGTTCTGGCAGTTGAAGGAAGTGGCAA

AGAAAAGCTCCCTCGTTATCACAGAAACGTTGGATTGGGCTTCAAAACCC

CCAGAGAAgtgagtttgtgtttgtattcatgattgtaactttgttgcaga

tgatgtctttc