nucleolar protein 10 (FLJ14075)

cDNA: Genbank BC047174

 

hi2806 is in the 1st intron

 

ccctctacgatcagtgagcgctaggaaccaatatagcggtgcatgtttcc

ggcaggactGTATCCAACATCTCCCCACTTCCTGTTGTGTATCCACGTGT

GTGTCGTCTGTCGTGCTGATGTTCCCACCGGTTTACATCAGTACTTCAGC

GTGTACATGAATATATATGTGTTTCTGTTTAAAAGCTCAACCCGAGCGCA

TTAAAGATGCAGGTTTCCAGCGTCAATAACGTCAAGATCTATAATCTGAG

TCACGGCAAATCCCTTCCGGAGgtaaaactctctaaaactgtgtgtgtgt

gtgtgtgtgtcactgttaaagtgtaaatacaggcgatgacagtaaataag

gaagagttaaacaccataatttacacaaaactcagaatagaaaacactaa

gagaactcgctttgtagttttactcgtgtttatgcgcttcagaaataaat

aaataagagtatactgttctgaaattataatggtaaataggaagttcgaa

tgtgtatagaggcaatgtaaagttggttttatatttggatattcagacat

tatccttaatatagaggtaaatttggttttatattcacacattcgttcgt

ttagaagtccctatattgtttacaataattgatgggaattagcatgcaag

tatgacttaaacaacattaacactgtctaattcactgtgaacaatgctgt

acttt

hi2806 (5-3)

gataatcatttgctgctaatatgatttctctatttacaatttgcaaatac

tacttttctgaaactatattattaaggagaatgtctgaatatcccaatat

aaaaccaactttacctctatagatattaactgttcaatagtacttataaa

gtatgttttatatagaggtaaagttggtttcatattcgcacattcggact

ttccccttaataatataattttattaaagcattatttgcaaactttacat

agtgaaatcatattagcagcaaatgactatcaaagtacatcattgttcac

agtcaaataaacgttgttaatgttgtttagaagtcacacttgcatgctaa

ttccggtcgaatattcaaagtaacatggtaaacaatatagagactgctaa

atgaacgaatgtgtgaatataaaaccaactttacctctattcaaataaat

agtgttaatgttgttttcaagtcatacttgcaggttatttcagaccctat

agttaaagttctgtggtaaacaatatagggagttgacactgaacaaatgt

gagaatataaaaccaactttacctctattgattttataatgtgtcccgaa

tcctacccaaaaacctaaacacaacttttaccttactagttattaataaa

cagataattagtagtttattaagctagtagtgttagttaatggcttgtta

atattgtgaattgtgacctaaagtgttacgttttttttttaaagtattgc

catttttaatcttaaccaattgattaatattgggcagtatgtttgttata

tatatatatataagaaaattaaaacttgacagaggtaaagttggttttat

attcgcacattcattcatttagcggtctctatattgtttatcatgttact

ttgaatattcggtcagaattaagtatgacttaaacaacattaacactatc

tgattcattgtgaacaatgctgtactttgaagtcatttgctgctaatatg

atttcactatttagagtttgcaaataatacttttgagaaaattatcttat

taaggggaaagtctgaatgtggcgatataaaaccaacttcacctctatta

aaacttggtggttttatctaattatttgagtaaatattcagcagaaaaat

gtatcataaagtaatcatgcattcaatctgacattgtttatttcagTGGC

TGTCGGATCGAAAGAAGAGAGTTTTACAGAAGAAAGATGTTGgtgagctc

ttttattgtttattattttattatcttttattgtttaatcattgtttatg

ttagacaatactagagttaatctgtcttgtatgt