MBD2-interacting zinc finger

cDNA: Genbank AY648714

 

hi286 is in the 5' UTR

 

aagtaattgttaaaggtgagttatttctcaatacttttaagcaccTGTAA

CTGCTCGCGCCCACAATAATAGTCTTGAAAGAAAACACATTCGTTTATTA

TAACCCGAAACTAACAAAAATGCTTCAACCAGCAAAACGAAGGCAGAATG

TTAACTTGCCCTTTTTGTTGTGCTAAGCAGCTATGCACCATGCTAG

hi286 (5-3)

CTTAACAACTCTGACTATGGTTTCATAAACCTGTTTGTGCTTTCGATGTT

TAATAAGCTTTCATGTAATGGATGTAATCGTTTTGGTGGAGTTCGTGTGC

TGAAAATCGCTGTGTGTTGTTATTCAATACAAACAAACTGACACTTGGCT

TGAGCTGCGGTGTGCAGAATTTAACAGTCATATTAGGTCTCACATGTGAC

GTTTCTGTTATTCAGAGGACTGGAGGACCACACGTTGTGCTTTATATTCA

GTTTTATATGCTGTATAATGCCCCCGTCAGCCAAACGAGGCCTGCGCAGA

GAGGAGCTGCAGATGGAGCTCGTCTGTGAATGGGGCTCGTGTCAGGAGAC

GTTTGACAGGATGCAGGACTTCTGCCAGCATGTGGAGAAACACTATAAAG

TCACCGTGGACAACAAGACAGACTTTCCAGgtgcgttaaacatgtggaag

ggccaggggtcaagatacgtcaatgaaatgtatttaacctgtatttagct

attcacttattatcctggttaaagtatatattttacccccaaaagaaaaa

aaaaattgtcatcacttattcacaccatgctgttccagatct