zgc:111795 (RIKEN cDNA 2410004I17-like;l establishment of cohesion 1 homolog 2)

cDNA: Genbank AY648804

 

hi2865 is in the 1st intron, before the ATG

 

ccatggtcaatttagtttattcaatttaccaatacagaactgaaaaccct

gtatacactttttgcattgttttggctcaacgaataaacggcttcacacc

atcttgatgttaattaattctggtttaacgtaatacaatagttgacaaag

atagattagaaacttttctgtcagtcgctaatcggctcattgaaaatact

tgtttaaaagaaccgatttgcacagatgaatcatagttcttttcaccaac

cggacgttgtcatgcttctaaaccctgtttccgCTTCCGTGTGCGCCACA

ATTGACTTTGGCGCGTTCTTCAAAACAGACCGCGGGTGAAGCTGAGAGGA

TTTGCCGCGGTTATTTTGCTCCAGTGTTTTCACGTAAATTCAAAACCAGA

TTTGGTACTATTCTACCCGgtaagtggtttactacaggtattgttttcaa

gtcagtatctgatggggtttgtgataaacggtacctacgtgtatttttag

agattatgtactgttcacctagttggcgcctagaaatgaactgcgggaaa

agtgagagagctgtgtttaggatgtaaccttataaatcgtatacataata

aagtataagtcaaacttcatatgcaaatatcatagcggtaatttctacat

gaaaacagtgttttgtttctttcacagttgcagataactgacgttaactt

acgtgtttcactgtttctgcaggttgtataaag

hi2865 (5-3)

taacgttaatatttaacgttaagacttcgaagaccttataaagaccaagt

aaaagtaacgttgtgttaccattacgttacgtagtaaattggcctttttt

atctcaagctaaagcacttgaactgcagattagctcgtcatatgcagtct

atgtttatatatttattagtgctgggcaaaaattaatcacattcaaaata

agtttttgacgtaatataaatctatgtattatatatatttattatgtata

cgtgatgcatacatattaataaaactataccaaactattttgttacatat

ctacatttgtatcatcaaatatgtatagaaaatgtttatttataattaga

ttctctctctctctctatatatatatatttttttttttcagacttttaaa

aaaaaatatatatatattttaaaaaacaagtctaaaacatgtttctacgt

atgcattctgatcattctacgacaaagagattagcaaaataatctgtttt

ctttttatatactgatacatctgaaaatgttttctcattttagGTGATTG

AAGATGTTATCCCGAAAGAGAAAACATGGCTCTCCTGATGCCGAGAGgta

acattgtgtagtttacttttattagatattaaaatatttgctcttgtaac

acaaatataaattttttaaaaccccaccacagTAATCCATCGAAGAAACA

AATAACAAGCCTGAGGAGTTCTCCAAGAAGGACCACTCGACAAAAAGAAA

ACATTCCCATTTCTCTGAATTCCCCCCAAAAGATTCCCAGCACACCTAAA

AAGACGCAGAGGGCCTTTTTGCTAGAATCTCCCCCAAAGCGAGTCTCGCC

ACGGAAAGCAGTGCTGGGAGCAGGGACCTTCTACAGCAAGCAGAAACCCC

TGTATCTCACACCTCTGGAGAGAAAAGTGCTGAAAGAAGCCAAATCTCCA

CCATCAGTCACTAACAAAGAGCCGTCACGCCCTCCTTTGACTGCTGCGAA

TCAGGTTGTAAAACCAGCCAAGAAAGTTCAGAAGAAACCCAGAGCTTCTG

CTCCACAGTCCAACCTAAAAGGCTACTTCACGGCTAAGCCCAAAGCGACA

AAAAGTTCGTCAGATAAACAAACGGATCAAGTGCTGAAATCCACAATGGC

TCCCATTTCATTCAGCAGTATGAAGTCCAAAGGTAAACCCAAGCTGGTTG

TCGGCGCTGCTTTCTTCAACACTGGAAAAAAGCCTACTTCAATGTATAAG

AAGTCTGCACAGAATACAAAACCTAAACCAACATACGAAAAACCCAGCAT

TCGGAAACCGGTGAGGGAGAAGGAATTGGTGACGGCACCAGGACAGCGTT

CCCCAGTTCGCCGTGCTGTTTTCTTGAAAAAACAGCCAGAAGTGGAAGTT

AGCCATGATAAAAGAGAGTCGACACAAGCGCCAATGTCTCCTCAGGTCCT

TGCAGATGTGCATGGCATCACTAAAGAGCTGAGGGTGGTTTTGAGGAGAT

CTGTGAGCCCTGAGACTGGCAGCCAGgttagattgaactgggtaatttat

gttgatagtgaataaagttttcgtttgttttgcttctaaagctga