N-ethylmaleimide-sensitive factor b

cDNA: Genbank DQ022212

 

hi2869 is in the 18th intron

 

aatgtgaaaaacatattaaaaagcctttattgacacggctatttcttaaa

actccgccttcgtattttggcaaacaactgcctttatcaaggtaacagcg

atcatgtgcgtctggagtttcttttgaatacttttgaatgatctcatttt

aatatctaaacaatactaaataatatataataatataactcaacaatcat

cattaatttaacattgaaagagggagaagaaaaaacgtaatatgaaaaaa

gttaataaataaaataaaataaaacaaataaaaacgataatttgtgtaac

attacatacatacacaacaacatatgtcttaaataatacaacgtaggtag

aatgaaaccacaaaaaaaaaaaagaaaaaaaagaaaaaaaaatatataca

cacacacacacaaaatatgtacagttgaagtcagaattattagcctccct

gaattattagccccattgtttattttttccccaatttctgtttaacaaag

acaacatttttttcaacacatttctaaacgaaatagtattaataactcgt

cctaataactgatttattttctctttgccatgatgaccgtaaataatatt

tgactagattttttctagacacttctatacagcttaaagtgacatttaaa

gacttaacttgattaattaggttaactaggcaggttagggtaattaggaa

agttattgtataatgatggtttgctctgtatactatcaaaaaaaaaaaat

aaatagcttaaaggggctaataattttgaccgtaaaatggttttactttt

attctagccgaaataaaacaaataagaagaaaaaatatgatcatcagaca

tactgtgaaaatttccttgctcaggtaaacataatttgggaaatatttta

attttaattttttttatttaagaaaaaacatttcaaagggggtttaatag

ttctgatttcagctgtaaatatagacaaataaactagtctagtgtacaaa

taaatgcagataaacatgcatgtacatatacaaatacataccccctgaaa

gagaactgatatattattcaagctacatgtgaacactttttgtttgattt

ttgtatcaaaaaatattgttgacccaaacatttgacaaagtaatatgtat

aatagtttatattttactaaaagtggtcaaccactggctaaacttgtctt

aaagtggttaaaaatttacatattacagacataaaacctttattacagct

cattgaatagaggtgtcttctgtcacatcacactttttacaattttcaca

ttcttttgaccaaaaccactaaccgactatctgagtttttggctacattt

gaaatatttatccgaagcatttattgtttttggctgtggcgatgtttttc

ttggtgaacaagtcccccaacaagctcctgttgtgtcttgctgtctggtg

gcagtgagtgtgtatgtcgtgctgtgtttataaggtgttttgaatagctg

agggtcttttcctccagatcaggactgtatagagcagctctcagtaggga

gtcgggtctcgggtgagtcgatagaaagggtttgtgagagagccgagacc

tggcaggcccgcagcctgtgtggcacctcatttacatgcactagcatata

gtggacaccacaggggggcgacccataatcccctgtgctcgctggggcct

ctgggaatggcccacctctttactacatgtagctgggcaccatggctata

ctaggagatcttgaaagtgagccagtgagagattctgacctttagtgttg

atttgatatgatttgatatgtttgtttgtttgttgatcctgcagGGTCGT

AAGTTGTTGATTCTTGGCACAACTAGCAGAAAGGATGTCCTGCAGGAGAT

GGGCATGTCCGACTCTTTCAGCACTACAATCCACATCCCCAACATCTCTA

CAGGAGAACATCTAATGGAGGCCCTGGAGgttagagatagaggaattcat

aagggccacattttcagtttgtttcaatcaatcacaagtgtaaaatgcta

aatatgggtgaagattatttaaatgtattgctta

hi2869 (3-5)

ttatctggataaaggcttgaggtttatcgctcatgcttaccatgagcatt

tttcaagacatttttcgttgtttatacccaagcgatgttaacaccaggtt

aaaacaataattcgttttgtcacgattacaggtttcaaggtaaactacgg

tcagtttgaccagttaaaccgctaaagtgtgatttaagtcacgttaatct

tttttctttcaagctattttttaccatgtttgctacatgaggaaaaaagt

ctgctagacatactgatcagaattgtgttcaggcagagaaaacattattc

atgtttttaacaaattcctagaaacaagaaaaaaatattacatgacaagc

tatacaggggtgcgtttcccaaacatgatgtaactcgcagctgaactatc

atagtgcgatgcaactttttggaaaagaacgataaagtgatgagtgtttc

tgaaaacccgtagtttctctcgcagatccatcgtttgaaccacattagtt

ataaccgtaaaacgcctataatgatgctgtaaacgaggtggtaacgactt

tgttagagaagaaccccataatttctttgtgcaaattatattgttttaag

cggacaaagaaaaaagaaaaaaaacaatattagttttggtaaaaacatgc

actcgtttttccatattattttccatattttttcaatggcacatataggg

cctatgtttcctttgcaaatattattgaggacattacatgttctactcta

aaacataaaatcacttacaaaagctaacacatattctaatctcatatata

aataaataaatactgaggctatttattaagaaatgaaatttaagatttat

tatttattaggaaatggaaaaaatcatacttatattaataatattgatga

tggtaatgattatgataataataataattatcattattattattgctatt

attattattattaagtgggatattgtttatttattttttattttttgaaa

agtctacttttacaacttgacacatgcaaaccactgcagaaatgttttaa

ccaacagacccatgtcatatacagtacagattctaaattaataatctact

acaaatttaaacgattaacgtatgctatgtttttttttcacaagctttgg

agacttttaacataatttccacttttaaataataggtcacctatagcttt

caacatgagccacggctgtgttcaaaatgacatcaatgttttcaaagtgc

actgtgaagggagcgcaattgtaaacacgaagattgctaaaactgaactg

aactgatctgtaaaaacactttgaaagcaaatcacgcctaagagagatga

ctttaatgtttttttttcttttttcttgtttttttttataattctaagtt

taaatgtcagaatgttctaaacgaatagggcatagggggataactaggaa

tagaacacagccaggaactttgtttctaactacagctccagaagtgttgt

tggaagcatacaactgggacgcagtttgcaaatgttggaatgacgagttt

gggaaacaccaaatcaacaaactatgtttgtaacaacagaacttgcaacc

ctagttagctaacgattgttttcggaaacgcacagcaggtttcctgtttc

tggcacataattctattttttttattagcattgccttcaaattaaattat

atttctgccactgtatatatgttttcatgacaatttgttttacatctaca

acagaatttttttttttacaggttttgaacatgtggaaggattagatct

 

approx 3.6 kb to next exon