replication factor C (activator 1) 4

cDNA: Genbank AY648805

 

hi2877a is in the 1st intron, before the ATG

 

caattaaaataatttattttgtcaaatatccacagttcaataataattaa

acagagtaagggtcccccaggagcacagacagattatttacgcttgaaat

aaatgtccaccattatgaataattacattgctctcaaaaccagcttattt

caaccagaaataaaattaacgaatcttatatttttggtagtgctggataa

tcacgtgatcctgatcatctgtggcgcgcgccagtgacgtacacgcgcac

gcgcccacgtcacctgCGCGTCTGGCGGGAATCTGAGGACCCGCGCAGTG

TCAACAGATCGTCAGGAGTTTTATTCGAGTTTATTTGACCAAAAAAAGAT

TTATTGTGATTTACATCGATTAAATTAAGgtgagaacaccagtcgcgact

gcatttacacatgaatgatctatagttatgcctattattgatgataaatg

atgaagagtagcgcgcggggcagactctatccagtgcaccacattgagta

actcaaatcaatgagatgtta

hi2877a (3-5)

tatattgattattatttatttagagagatgtgatgttttaattattattt

atagttaagagaaatttagttttttcaattatttgtgtttagaagaggtg

ttatattgtactttgatcggaaatttatatggataagagtcgcctttaac

gttagatgttacatcttatttttgtcatcaggcaagtagagaaatgtaaa

tagacagattcagcaagtatgtctgtgtgtttaaaagaagtattgtagac

ggctttaatgaaatgaggctaggctcttagtgaacatctaacgttaatac

acatctgaaaatacctcaaaactagactaatcatcatcaagaatgaaaag

gcttgtggaatctgtctcatctgtttatttaataactagtatagttttgg

taaataatatagagctaatttgggctgtcagaaatatatcaaatgacatc

tattgaagttaaatatgttcgctgtacagtatcttctttttcaaactgat

ttaaagattcattttgaagcagttaaaggacattcaagtcga

 

approx 1 kb to next (1st coding) exon