40S ribosomal protein S29

cDNA: Genbank AY561513

 

hi2903 is in the 1st intron

 

caataataataataacaataataataaacaaacgaatgaatgaacaaact

aaataataaacaaacaaactaataaacaaataaataaataaatacttaat

tttaatttaaaaaaacaacaatattatgtgtaggacttcctcagagaaga

cttcagggattttaaaaagaccattcaatattttttttaattcaccatca

ccattcctacacgagggcaggtatttgacactatacatgtacaatctaca

ctataaaataaacaaataaacattttcctgacttctgtaatgtggaactc

gccctcggaatggcgccgttttttagtgtgggcgcaggaagtggcgggtt

ccgtagaagaagcgcgtcttttttgcgcctgcgcacaagatccacttcct

tttcgacatccCGATCGAGAGAGACGAGATGGGCCATCAGCAGCTCTACT

GGAGTCACCCTAGAAAATACGGCCAGGGCTCGAGATCCTGgtcagttctg

ctcagtttggtgtttaatgtgaaggttttgtgtttgtgaaggttttcgct

cggtcagaccgtcgtgtgtttataatatccgcgggaatgcggagcacatg

ggcggcgaggatgatgcgcgctgacaacatggcggacggagaatagttta

actgccgattactgg

hi2903 (3-5)

aaacccgaataaaacgataaacacttcatctaagtatgatatcaattcga

taatagtggtctctcctatatatagagagtgtctagaggattttctacat

gtttggtcacagattacagacttgcgtagtcatttaaatgtttatataac

atttcacacttttattaagtaacgatttaatgttttgatgccattttgta

agcatttaatcatggataatttgtggtttaccgctgtcgactgtgttaac

caaaactaaagtagtgttcatggttaaaatgaactagttttactatggta

tttgtggtaaaactgctggcaaatggaagtcagtgtaccacacagccata

gttaacttgtactattttaacatggtttatttttacaaaggaggaccatt

tgcaggtcataattattaacacgaatttctggttaattcacaaagttatt

attacttgtatttttttaaccagttaacttataatattatttagtaacta

actgcttgtagggggtttaaacaaattgctaagaaaattaatggatgttt

gctgactttatgaagtgtttcgtatcttaaaagtagggctgcacaatatt

agaaaaacattgcattattgttctgcgttttttttatattgcgatatgaa

tagtttcactcgacgagttgaataaatgttcaaaaagaagctataatttt

agattgattgggaagattctgtaggcgattgcataatgtaatttaacttt

atttgtatagtacatgaacataagtattatataagcacaatatattattg

accacaatatttgtataatatgcaatctaccagcatacataatttcaata

aaaaaaatatgctaattaaacaattttattgttttccgaagaatcaaact

attcaaggctacagtaatgtataataatactacgtctttttttataaaca

attccattaaactaatcattataaatttttgcaagttacaaatagtacat

tttcttaagcctgaaagcttttaaagccctcacacagtcacaggcctaaa

aaaaaccctgagctgttaataattattaaataaaaatctaagttttttcc

tgttttctatccaaatatctaaatattttaaaatcaagatgcatactaga

cactgagtgaaatttcactcgatgatttgaataaatgtttgtaaagaatc

tataatttcagattgattgggaagattttgtaggcgagtgcatataagtg

aactttatttgtatagcacatgagcataagtattatttaataagcgtaat

atttatattattgagcacaatatttgtataataagcaatcttttattaca

aacagtacatttttcttaagcctggaagcttttaaaaccctcacagtcct

taaacacttgcatgcatatacttgaccttgcatatagttgaaatgtgaca

attgcgaatgatcatattgcaatatcaatgctgaaacagtttgtcttgcc

ctaatttaaaaggataattgcattacaatttgcttaaattgtaatgtaat

aaaaataaaatgtggtatccaaacgttatgtttaaagttttaccccacta

tgcactatgcataagtcaatgcaccaaacaattatggttactacagtttt

accattagaaaagcattagattaacttattttcaaagatgactgttggca

ggtcataaatgtagcattgctgtttttcccccacaaaatgcagtttaaat

gaggtactaagaaaataaatagtgatttgtgtacgtttaatctgcttttt

tattgaaaaaaaaaaaattatttgttttaagtgcattgttaatacaagcg

atggtacacttatataaaaatatatattttattaaagctttgtatttttt

tccttttttttttacccaaaagaagatattttaattaataatggaaactg

gtagcattgacatccattgtaggaaaaaaaaacgtgtaattcagtggctg

ccgctttccagtagtctgaatatttttttgtgctcagaggcttgaatctg

aatttcattatattaaagttgaaccgtcccttttaaagtccttgtaaaat

caaaatttacattgtttattttgctagctcgcattgcttttcctaacatg

aataattagtctgcatgttaatccactgaataaagatatattgatgatct

acaatcaaaagtctgagcatgttttcatactgctgacatcaactcgaagg

ctttcatagcaactttatattaatgaacatggccattccccttttattgt

tagtttggttgcgttaattgtaagttgggtaaagtctagaagggatacag

ctgaagacgagcacaatgtagcatacattttgtgattctgtacaaaaagc

agtattatgagggttggggcaggtgttaattatgcagtttaatgtgtaat

atacatttcataattactgtatgtgcataactgggtggtaggttttaata

taatgcaattagtgtattttattcagtacaataattctcttaattactgt

ttttacattactgtgatggttgtggtagaggtagacgttgaagttcattt

tatgtaattaataaatctgtcataattatggtttttacattgctgtcagg

gttgtgtttagagtaggggtagatgtagactttaataaaatacaatcaat

gcaaatctacaagcaaagtctgagcatgttctgctgttgacatcaacctg

agagcttccataacaactgtatatcaatgaacttcaggatacagctgcac

atgtgcaatcaaatacagcataaacgtgcaacaataatagctgtttttgc

tactgtgatggttgggtttagggttgtggttgtagtagatgtacatttaa

tgtgtaatttaattattttaattgtaattaataaatattttattataatt

actgttttacattgcatgtgagttgggtttaggggtgtacgttaataaag

tacaattaataaatttaatatgaaattttaaatttaacaaattataaatg

actatcattataaatactgttgtattaccctgaggattgggtttagggta

ggggtaaattagcgtaaatccaatacaattaaattagttttttaatacat

ataaattcatcctgctgcagctgtatcccttttagcaacaactgctggtt

tgctatgcaactgacgtgcaaaagaaagccccgccccctacttattattc

agtttcagtttgaagtacatcaacatactgaaagcccgccccctactcaa

tattcagttggatgtacatcaacatactgaaataaaagtccacgtgaatt

gacatatgccgacttaaaacaatgcacttctattgtaaccgatgctcttg

ttgtgttttgcagCCGGGTTTGCTCAAACCGTCACGGACTGATCCGTAAA

TACGGACTCAACATGTGCCGTCAGTGCTTCAGGCAGTACGCTAAAGACAT

CGGCTTCGTCAAGgcaagtattactaggcttataagaagtgatgctcttc

ataaagtgattgttggtaattgagtgaagggctgcaca