cleavage stimulation factor, 3' pre-RNA, subunit 3

cDNA: Genbank BC045871

 

hi2908 is in the 1st intron

 

cacgcgtggtcgacggcgacgagtcgaatagtgagtaaaagtattcttag

cctaaatagttctaataaataatagtatttcagtcagcaaagcatcgacc

tttattttaaaatgagtaatttcctgtgggcgtgacgcaacgtcttcgtt

cacgctggtgccattttagtgctcggcgagggacgagcgcccGCACATAA

GAGTCTGCACAAATAAACAATGCTGCAATAGTCACTGTCTGCGCTTAGTT

TATTTGTGAAAGTAGAGCAGTCGACGTTCCTTTACTCGGATTGCACCCCT

TTTCCCACCATGTCCACCGAAACTCCACCGGACCAGgtaaagtaaagaca

aatgtgcaagtgctcgtgtttgcggcctagcgctagctggtcagctatct

cttcgcaagacgaatatcgatatttatacgtttgccacacggtttttgca

gtctgcgtcgagtgtttgtgcagcacatgctttgttt

hi2908 (3-5)

tagtgtaataagttagtgagacatttgagggagtgaagtagagagtcgtt

gacgtaatgatgttgcttggtgatggcgatggtaggactgcggcacagca

cgatgctattgtttgctaacattacctgcactcgtttttacaacttgttt

attggcattttaatggatatcctgtgtgagactggaagttgagattatac

ttcatattagattaatataatgattgaggtttggttatagctttcga

 

unsure how far to next exon