WD repeat domain containing 82

cDNA: Genbank BC044174

 

hi2914 is in the 1st intron

 

acagtagatggagaagccatgtgaaattctgcatcctcgttacagctgtc

atttcagtaccaaattactagaataacctcgttgtttttcgtgtacgtaa

tggaaggttaatatacagagcgtataataaatcaccctaaccaacaaaaa

cttccttccaacctcaacgtcagcctaaatcgtaatgggacttttattct

gAAAACATTCGCAGGGGTGGTGGCCATTTTGTAAGTCACCTTGCTAGTTC

TAGCTTCATCTCGTCTTCCGTAATCCAGTTCATTGACCCAGTTCTGTCGG

CGGGCTTTTTTAATGTGACAGAAATACACATCTGAAACCCATTTTCGGTC

AACAAAATTTTCACGACACACTCGCAACGCACAAGACTGTTTAACCAGAA

CCCAAACTTGTCGCTGTTTTAACGAAACGATCCCGTCGCGCCTGGCCAGG

CAAGAAAGGCCACAATGAAGCTCACAGACAGTGTGCTGAGGAGTTTCAGG

GTTGCGAAGGTTTTCCGAGAGAACTCCGACAAAATAAACTGCTTTGACTT

CAGTTCAAATGGAGAAACTGTAATATCGAGTAGCGACGATGACTCGATTG

TCTTGTACGACTGCCAGGAAGGAAAgtaagtcgcttgtagtttattcgat

gtggttgtcctgcaactgactgtttcgttttaattcagcgtttgttgtgt

tttatgtaagttactaaaatgggataaatacctagatctattgctataat

gttaatcgtgacaattattgcctatttatatcgagtgttgt

hi2914 (5-3)

gtaattgcatgcgtttgtgtgtacagttagcggtctcttatttgtaattc

ggatctttcaagtgaatcacttgaactgaatcactgagcttcgttccgtt

tttttttttagctgtttccgttcttcatttagtattatgttttaaaactg

ctgaaaattatctgcaacaaactttgagaatcaaaaaaactttttttatt

ttattgctttgttgttatgtaacttgatacatttacttgatagtgcgttt

aatttgcgagagaacttgaacagattttattttaaggtgaaacatgactt

atttatttggattaagtgtttttgtttgactttttttgagtctattacca

cttttttgttaatttttaaatcccaaattctcaaaacaagactgttcgtt

tgcttcgtaaatgtatagtatcgatgtgtgaacctttaacgttacatgtt

tgtactggaaagcaagaaaaaaatatgctatagtaaaaccttttgcagcc

atgttcttgttttgagtctaattgtttattttaaatcattatcttatatt

ttcttttctaaaaccttaaccattcgtaacgtagcgacataaaaaaaatc

gccatatcttgaaccgattctttcaaatcagctctttgaaaaaactgatt

ctctgaaatgaatctaatgtacagacgcgtgctaactgttagcatccacg

cctcttaaaataatcggccgcctcttgactgtaaaatcaaattatgttat

gaatttttgcatgttatttatctaataaaccagattaacattttccctct

ttaaatcagACCCAAACGGACGCTTTACAGTAAGAAGTATGGTGTGGATC

TCATCAGATACACCCATGCAGCCAACACAGTCGTCTACAGCTCTAACAAG

ATTGACGgtaggactctttaccaaactttagtgtgataacgtgctgtttt

tcccccagcaaattccattattttaagctttagggatgaaatgcttattc

actgagccctttttaacttgttttattacatttctcaatgttatgagtgt

tatttttcaccttacattttcataattatgt