eyes absent homolog 1

cDNA: Genbank AF118106

 

hi2933 is in the 9th intron

 

gagcgagctttttaaaacatgtgtacactcgcatattactcacatgatat

gaatcactctaaatgtctcgaccactgtatgcacagattacctcttgctc

tttttgtgtatgaattatgccacgagcggagacaaaaaaacgagtgaaga

cagatcgctgtccagatgtagcgcagaggagacatatgttcacatttacg

ttttggaatctgtgctgtaaagtagcagggttgcacgctgctatctcaca

ttaccgccttgatgtctttgtgcagGACTATCCTTCCTACCCGACGTTTG

GCCAGAGTCAGATGCGCAGTATTACAACAGTAGCCCTTACACTTCTCCAT

ACATGACCAGTAACAACACCAGCCCTACTACACCCTCACCACTGCCACCT

ACACCCTGCAAGAACCTCCATCAGGGATCACCAGCCAGGCCCTCACAGAG

CAGCCCACAGgtaagagagacccatttaggtggaaaaaaagtttctggct

ggaggtctgaaaatttgagttactacaaagaagagagctgattagctgat

tttgcaaactaaacattgatatagatttacaaattagagattgttttaca

atgtttttatccatataaataggcgctatgtactgtgctgaattaatgaa

gcaagtttgttattttttttttttttttggtcattcataaatttcagaat

aaaaaaaacaatatttctatttttagacaaaatagtttagaataataaca

gtaaaatgtaaaattagagaagaaattggagaagactttctatcattgat

gacaataattataattattaggctgctttcaaacctagacttttgtttgg

aacctggctgtttctcagcaattggcttagatctgcacctaagcaatagg

tctgagatcgcctgactggggtggtctcggctccaataaaatgaactctg

gagcggatcaaatagtgagaaagcaagatgatccgaaccaggctgtatcc

actgtgtattatag

hi2933 (3-5)

atatgtaatatcatatacagtatacggctatatgaggagataattatgag

taggactggatgtcttcattcctaatggtaaatgtgcatttcatgtcaaa

tacgaacttgaaagaatgctgaactattaacaagagatgcttatctgtta

ggaaaattgaccaaacagtagttttggtttctgtcttttatttatttcta

taatgtgaaagcttataatgcataattatagccaacagctatgtatgaga

aagtcttatctctaatttatatctggtgacgatgtctgtgggtgtggcca

tttaaaattaaagtgcagcttttcactaataatgtcttattgctcatcgt

cataaattaaaataagggcgcataatagctgggcaggactctgcaaaata

aactgtgaaactctgaccaatgagaggagagtttgctcgcatgtgacatg

ttttagctattatggtccatttagaaactttgccatgtgaaagcgaacca

caccaagaacaaagtgcaacattgtaacaattttaatccctgtttcggaa

taggtgaatcgattcacaggtgtgtaagcaccctttatataaaaatacct

attgctctgttacataaacagaaggtcatcatgtatacattgtaaaaata

aattgttgctgagttaaagttttaagttgaatcaaattaatgctacaagt

catttaaaacttacaccaattaaacccatttaggtaacactttacaattt

taaaatgttgattaacatttttttgtgaataaaattatcaaaaaaaaatt

gaaacctgatttaactaaaattaaaaacatatgttgtcttgactttttga

ataaattgcctttacagtgtacttactgtagatatatccccagctatttt

atgtatttgcgagtatttaatatagtatttcatgtaatagttttatatta

tatttattttatataacagtttgaaaagaatttacaacaattaaactgat

ataaactgtgacttacagtaactacccagcaggcacagaacgtcaacaca

acgtcagattaaaatcgggtttacatcagaatccaacatcaggctgacgt

caatgtccaaagtcggacagacgttgcattttggtaactttccaacacag

cctaaaaacaacaaaatgtcaacgtctattggtgtttcagcttgacgttg

tgtggactttaccacttactttaatcaaacattgtattttggttgctata

cctgacgaataaatgtcagcatttgacgtcaatatgatgttggtttaaga

ggttggctagatgtaaaatttcgttcactttccagcacaacctaaaatcc

accaaatgtcaatgtcatttaacgttgtttttataactttgtccttagat

gctggtgacctaaagctaacctaatattagcgtcttatgatgttgtgtgt

ctgctgggtatgactaaaacttaaatctagtaaaatacaataatacgtca

ataattatgaaatctgattgactggttaaaataagttaaattaacctaaa

acatatggtgtcatgtctttttgatcaaataatttttaagtgttattttt

atagcaaatatacatcaagatagtttgagaagaatttatagtagaccaac

ttctgcttattaactgaaccagtgaaacattctagtgctgttggattatt

tttaaaataagtcttggccaatcaagctcaagagccaggctgaacatatt

tacagtatacataattgaattaacagtgaatcagtgaattaacactgttg

tttccaagagacaataaaacactcttacatttgccttgtcgtgtaattga

gagagaacaatacaatgcagaacacctccagtgccattactaatgcttaa

aatgtttctcgggtataaggagatctgataaacaacatgacactagagca

tgtaggcagtactgagctccaaatgaggtaaacagatctagccacaatgt

gaatatattttttgcctttctttttttctgcagGAGAGTACAGTACAATC

CACAGTCCATCAACCCCCATTAAAGATTCAGATTCAGATCGATTGCGTCG

GGCTtCGGATGTAAAGGCACGTGGCCGAGGAAGGAGGAACAATAACCCGT

CTCCACCTCCTGACTCTGACCTTGAGgtaatacactgtcagtgtatctga

ctttgacaacactgactcattaatattaacattataatagtaatctttat

aaaatcaagtaatagtttataaaaatc