UTP11-like, U3 small nucleolar ribonucleoprotein

cDNA: Genbank BC049053

 

hi2937 is in the 5' UTR

 

agatctatttttggtactataaactattttcaaatacagctcttataaat

acagctcttataattttagattttaaataaggcatccacagtctagaaag

ttgcacatgtattttcttgactataaaatatttggtgtggtggttgaaat

tttagattagacaaatacaaaatattgagcctcacaattacaaaatagat

taaacacactatgagtcaaaagtttggggtcagttttttttaatgttttt

tttttaaagaaaattattctgttcttcaagggggcatttattaaatgtta

aaaaattgtaaattgttaaatattaataaaaatattaaataactgctttc

ttattgaatggagtttcaaatgaaattattaatccagccatgattgcatt

taatattattaccattaataattatattattattaataataagtaatagc

atgatttccaaaggttcatgtgactgaaaactggagtaatgaacctgaaa

attcatctttatatcactgcaataaactattaaattaaacgataaacttc

ttttgaacagttattttaaagtacaataacatttcacaattgtacaattt

gtactgtatttttaattaaatgaatgcagctttggtgagcaggagaagct

tattttaaaacatttaaaaatcacactgaccccaaacttttgaccggtaa

ttttacttaaattatatgtaagaaaggtttatttctgcattacagtttgt

aggttcctcacctgtcccttttttttgcctattacccaaccataaaaaac

tgggaaagacttgcaccactagaacatgatgttctgtaattccaagtaat

gccctgtgtttttgagccagagtaaaagctagttgttattttaaatctgc

ccttgcttatatcccatgccctgcatgttttgacacaccaattggctgtt

ttctttgccttttcattctcagaagacaagccaactaatggataaactgg

acctttggagctataagaggcgcacaggtgtcgtcatcagatttgagctt

ttcacatttgtcacactaatggccgaaagctgtccttctgcttaagaatc

taatggggtgtctggactatagtagtaaaacctgtttgaaaaacaccaag

tgttatctgttagtgttaaccaatctctttggcagatagaggccgtcatt

atcatgaccaaagtgatttaaagtgtcaacacacaggctaggatatataa

accaagtgtctcagcacccaaggtttgttattgagttcttcccgccatga

gtctggctatcttcctcacactgaacagtggacaaggcctgtgatggata

tctctgattattagatggccatataaagctaatgttgtggtgttcgctca

gtgtcaaggatacagtgtgttagtggagcttatttgtaatttttgggact

ggaatggttggatttaaaacatgattttatcggagtcagaaacggatttg

actggaacttttatttaaattttagggatacatttaggataaatctgttg

cagtgtgtataatgcgtggaggaccctgccatctgctgtcgacatttgtg

aacaaacgtttctttggtactcattttaaaattaaagtatttacataaag

attgtatttttaatcatttgctgcttttacacaatcacttttattttgta

tagtttttttgtttgtttatttaaatattatttttattcaaagacctaaa

cttttttttgctccgaatctgctgctgtgaatcgtccagcAACTGTTTGG

CATTGTATCCACGTGAGTGCGGAACTGTACATGTGGGATCGTTCGGCGTT

GATACGAATTTCTGTT

approx hi2937 (5-3)

TAGGTATTTACTAATTATAAAAATAGCATTGGTCTTACATATTTACAGCC

ATGTCTTCTTTTCGAAAAGCTTTGAAGTCTAAACAACGAGACCACAAAGA

GCGCTCACAGgtatgttttaacgcactgttgactaacgttagcgtgttgt

attgctaacttagtaaacgcgttttatattatagaaataatgtatttaag

cttacttgtaatattttgcaaatatgaatttgtagcggtaattttacgag

ccaattttacacggggttactgaaaaagaatgggtcctatatgtt