proteasome (prosome, macropain) subunit, beta type, 1

cDNA: Genbank AY648806

 

hi2939 is in the 1st intron

 

tatttgctgctgtttgtacctttttgtttctagattaaaaaaacagataa

gcagatttaccaaaaaaaaacaaaacatttttttttaatggtccaactaa

tttgcaattaatatccgcaatattattatcatcacggatatttcatatta

atcattcacctcaagactagcagcataaacattgtacatatgtagactta

cattaaaatctaatactaggccaactttgatactcaatatagtatgaact

acttctaaacaatactatacatgtgataaacattttttttttgtaaacag

caaatgtgatgatgaagtagtacaaaacatgctttgtttactgcagttat

gttgcttgttgacgctaataataacacgacacattcacttcagtcacctt

ttctttctttttttcacttaatcgcagatattattgaattgtgtgacgac

ttgtcttgctttattatcacaatcctcgcataaaaagtcttgtttatgtt

gaaaagctagccattagcagcagacggcgctgtggcggtggcgcgcacgg

gaaacaaaggacctgtcaacttccgacggCCATATTGCGGTGATACAGCG

AGTTTTGCGGAGAGGAGCTCATCATGATTTCTGCCCAGGCTTATGGAGAA

AACGGCAAAATGAAAGAATATCACTATACAGGACCAGTGGAGCACAAATT

CTCCCCTTATGCCTTCAACGGAGGgtaagaagatatattgtcctccattt

tcattcagcagagcatccagcgaacatgacaattcacttcacagctacga

ttcagccataaactcgtcttataaactgtttagagactttaaatttgtac

attttacacaaataaaatgtccgagagctaagtttagtaaaatcacgggt

gtagcagcagtataaattgagctaaacagtgtgct

hi2939 (3-5)

tattttactttcactatcacaactgcagaaattgactattcatgtgttgt

aagtcaaaaccgatgatatctgaggtaaaaacattaatatttagacctaa

tatggtttattattgatgctaatttttaaaccaaacgttgttttattgtg

ggacgtttatattgttcttatatttgctcctacatgactaaaatactgta

gtaatttatagtaaatactgtagtgcttttaaatcatgctatagtgaagt

gtattatactgtatatattataataatcactcttttaaatctattaatga

aggccccagtacactatagtgaacagataaactaataaatgctgtagttt

tactaaagtaaactgtagtttattgtagtataatatactttaagaaaatt

tggatttgtttataataatataagtgtattaactattgaaataacacatt

gaggtaaagttggttttatattcacacattcacacttaatgatacagttt

agacaagtattatttgcaaattctaagtagtgaaatcatattatcagcca

gtgactgtcaaagtacagctttgttcactgtcaattaaagactgctaatg

ttgttttgaaggcattcttgcatgcaatttcacaccgaatatttaaagta

gcgtggtaaacaaaataaggagcaagttgtcactgtacgaatgtgctaat

ataaaaccagctttacctcaataaataataagagacaagcagagtcaagc

agttgtgttgaggtaacgttggttttatgtttacaaattcaagctttttg

attaatattataatttcagaaaagttatttaagttgggaaatcatatcgg

cagccaatgactaacataacatcagttaaaaagtgctaataatgttgtaa

agcattaaagtgaacaaatgtgtgaatataaaaccaacttcacctcgatt

tgtctgtctttattaattgtttattttctcttctgtttatttaaatgagg

catttgtatatttgtgttgaatctgttctcagGACAGTGCTGGCGGTGGC

TGGTGAAGATTTTGCTATCGTGGCCTCAGACACACGTTTAAGTGAAGGTT

ACAGCATCCACAGCAGAGACTCGCCCAAATGCTACAAGCTgtgagtgact

gttattattattttaatatatgtgtatgatataaaggcaaaaatgctaat

ttacctccagattgttagtgggccgcttcggtaagtcatggtgaaaatgt

atatataattatgatt