cerebral cavernous malformation 2

cDNA: Genbank AY648715

 

hi296a is in the first intron

 

aagacaatgcaaagcccaaagctacaacgagtaatataaacttcccatct

tctgtgtttattaataataacttaccgtaagtatttatagtatgtgctga

tgaggttttctgtttgtctcgcaaagcactatgggtagacgtcctacgcc

caaaatggcggcaggattgaaaagtttgttgctgtttttgttttatttta

ttatatctgttcggtctctgtcctttttttcataaactccaagttttacc

tcgacaaataaggtcgctcgtttcttgacggtccattagcacgtgattct

gaatcgtcggtttgttttgttagatcgccgaagcgccgccgttgacgtgt

aggaggcagatggcagtgaattcgtggacatcagcacatctaaTACAGCG

AAAATGAAGAGCATTTGTACGTAGAGATGGAGGAGGATGTAAAGAAAGTC

AAAAAGgttagttaacgctgtaatgtgaccagagtttactcgtgtacgac

acaacaactgcttagtagcttaaacgtgttggcctaacttaaccacgaat

taacacaatgttaactctcttttaaaacatccgtgtgtgtattcatacct

taagttatgtttagaata

hi296a (3-5)

atttccactcgttatcctgtgactaaactggattattaaggaaataagtg

gtgccgctctttagtcatgaatacaagttacttacgctggccaaagataa

acactgagattctcagcatgtgactttaccgtgattgtaaaagatctggc

gcttgacatttccttctgattcttggtggcttttggtaaagtattcatat

tcagtcagagatgtacagagcccccgtatggccacgtagaaaaatctaca

ctggtctctggaggttgatttcgtggtttgctatgtaacgttaacgttaa

atactaaaagcctcaaaacagtccgtttagcattgagggaaagttgtttt

ttatttacacatttgctcagtgacaacttgtgccaccgttcctatattgt

ttaccatgctactttgaatattctggcagaaatagcatactaggatgact

tcaaaaccgcattagcactgtttaattgactgtgaacaattctgtaacgt

tactttgatagtatttggctgctaacatgatgtaattatctagagttggc

aaaaaaaaatacttttctgaaaatataatgttaagtaaaaagtcagaata

aaaaaacacttaacctcaatctgttcagaaatggaactaaccaaaaactg

cttacaaaacactttagttttttcaactctgtcttttagttcttaatgat

aaaaatgtctaggtcctaatatattttcagctcaggattgtgaacctaga

attcaaagactttctagtgtttcatttaaattattcaggcatggttattt

ctaaagtaatattaaataacctaaataataatgaggtaaagttggtttta

tattcgcatgtatgttcagtgacaacttgagacatgctccctatattgtt

tatcatgctactttgaatattcattctgaaatcgcatgcaagtgactaca

aaacagcgttagcactgttaaattgattgttaacaatgttgttctttgat

agtctttggctgctaatatgatttccctatttataattggcaaataatac

ttttctgttaaagtgtaatattaagtagaaagtcagaatatgaaaacaac

tttacctcaatccgttcagaaataactagccaaaaactgctaacaaagct

atttttttcacactctttgtcttttatctctttatcataaacaatgtata

gatc