ski-interacting protein

cDNA: Genbank AY648716

 

hi296b is in the first intron

 

tactagtatgcgttatagcttaaatgttaaaacggcttgccataagtggt

atttccacatgatatgtgctgtcagaagattgtaggctaatgtatagtct

atactttatagtttagataggtatatatagaatgtatagatatattcgat

acatataaagcctataaaacgctaaactgtatattatcctctttatacag

ttttgacagcgcttaatcccttaattctctaaacatcgcgagaagttatg

agacagtagagtgacgtcagaacgcACAGAATCCAAGATGTCGCTTACAA

Ggtaagacgcagagaagctgtttttaaggttttatgcttcgatttatgtg

ttgaaacttaacttaaagagcgtacgtgtgttttcatgtatgtacattta

cagtttgtgaaaactctgtgttagttattacccaagttgtgttatgtgag

acgatgaggcctgctgtgttgtggtctttgttaatagtgaatgctaagct

aaagctacagccacagcaaaagcaaataataacatatttaaaagataaat

ggactttgaat

hi296b (5-3)

atctcattattatgtttttattcattataattgcttatataaaagctatt

tataactttaaaaatatatatttattcctggatgtaatgtgtaacgttag

gctaacgttatttatcatcgtcgtagcaattttatttatcagtgtacata

tgcactattccaacacactcatagctctgcccacccccaagagacggctg

tgtttgtggctcttaatgcttaacgttaggtagcattaactttttttttt

gacgtaatgttacaattgaggccattcgaataacgttagtctattaatgc

aataatattttcacgtgagatcgagccactgtttcaacatcaatcaccca

cgttccaatgaatataggttgaattttgcatctacattgcagtaaagttg

gttttatatacgcacattctgtttagtgtcaacttatgacatgctcccta

tattgtttatcatgatactttgaatattcagtctttaatcatatacaagt

atgactcgaaagcaacattagcacaatttattttgattgtgcaatggtat

accttgatagtcggtgattgcttggcttatatggtttcttatgtagagtt

tgcaaagaatacttttcttaaattgtattattaaggagaaagtctgaatg

tgtgaatataaaacaaaccttacctcaattgttagctgatggtttaataa

tatgtcatcctggctagggctgggccattagacaaaaatcaaacttcatc

ataagtcatcattttctttactttattcataacgtcatgatgaatgtata

aatataaactaaaaattgcccagtggtttagtgtacagtgctcatggtgt

cccgagttcgaggcttgtggacctttcctgaacttctctctcacttatct

tcctgtcattctgatttactgtttaataaaggcaaaacatttcaaaaata

catctcaaataataaaattgaaatatttttagatgttttttttttaagat

tgcaactttcacacagtgctgttattcatgtttttgtccacatcctcata

atgtagtgtaatattaaaataaaataaaaacataaaatcattaaaattct

gaaaaagtattactgttaataatgtattttgtgacaccacataggataga

cttttaaaagaaattattagattgcacatctcttaatctgacttggctct

tttccccattctcttttagTTTTCTTCCTGCGCCCACCCAACTGTCCCAG

GACCAGCTGGAGGCAGAGGAGAGGTCTCAGGCATACAGATCCCAGTCCAC

TGCTTTGGTCTCCACCCGCAGAGACCCTCCTCCTTACGGCTTCAGAAAGT

CATGGGTACCCCGGGCTCTAGAGgtactaacaattaaacattacgtgctg

atagctgtcatatatcctgctgcattatgggcttgttccaatacccgcat

ttgtaaatagtcaagtgataagaccacatgacatatccagtgtatttaga

aagtgtggttgcaagtgggcctgatcagggctgcacgattaatcgaaaaa

aagatcatgatctcgatttgaccctacacacgatcttaattcagcttttc

tacgattcagccaattcaaggtcaggacagaagcgtaaaggcagtcgcac

aagccttcacagcaatattgacaccttcaaatggtgttaaaagtgtcaca

tactatatttataaggtataattctcccagaaatgtcattactgtcgaaa

tgtaatgatgtaatgaccgcaacctgtttgtttactaccgagaacacgca

cgtgtacaaaaatgactcctcctttagtgaacagaacctgcataggctgt

gaaaaaccgtagactgtaaattatatggacatagtgtccgtgacgtcgcc

cataggtttctaaagcgtgcaaaagaagccacaagtaggcgtcgccattt

tgttcgcacgtcatcacactcacggcaagatacccaacaagggcaaagag

gcggagagtaagcagagctacagacacgtgctggcatttagcttggacct

ggttcagacacactttactttgggagaacgcttaatacttcatcacctgt

gactcgtttgtattctgaccacatgtgcttggttgtatactatatcaata

aagtgtttagacttttaaaaacactgctgtaatacactgagccactaaac

attgttcttatggcgtgtttcaacaggaggaaaacgcaaattacttccaa

acacttcagatatagtctgtgttagttaatgtaagactattgatgaaatc

cagcataacactgtatgacaatgcttcagatgactgttctagagcctaca

gctaatcaattcttcagattctggagtgcattacagctctaaatataaat

gataaatgatcttaaataaaacaagtacatgtatagagatgttatataag

tatataactttactcacatgggaaacggaggccacgtgaatggtttatga

gcacaattaagtgcactcagcatgccatgccatctaataattgtaggaaa

caagtccaaaaggcagttgactgtgtaaagccacataaaacaacacagaa

atacgataaatatgctgcgttcagatgctaatctgcaggattcagctggg

gtgacctgacggcgaccaacgcgacctagctgtcactcaagtggccacgc

ccttaattatgcaaacttaatataacctaatataaaggaaacggatgagt

tataaaaaaattcacccccctcacagttgtcatgaagggtagtattagct

gtattaaccaaaatcttttttgtaccaggctgtaaacacctttttttctg

ctctaaagttggccattctaacagtgggctcaattgaaatttgctctatt

ttggagccaggagaattggatcggatgaattgcagttttagttacttccg

tattggcttcctgagggagagcggaaggttgccgcttgtgaaaaacatgt

aataaagttgtaaataacgttcagtttgttgcacagaacgatcgtttgag

agtcgtgctaaaagaaagatttgcatgtgtgtattgttttctcagagtga

ctgcagcgcactcggaagtgaaagtaaagtcggcttgcaaatcatttata

taatcataacgcgttttacagttctgattacaacaaacatttgatatgtt

ttttttctttcatagtgaacacagtgttgtgcatgaaaatgaatgtttgc

tatgtcaggataactaccctagcctatataatgataaatataatgcaaga

aggagtctgataatgacaaatgtctcattttaccagtaaaaatgttctaa

tgatgttgtcaatgacaaatggcaagcacttgtctcaaacataataattc

aactttagaattatgaatagttgtattctgatgtcataattttactgtga

attaacaaacggtaataataagtgttatgatatttcttttggcttgtcaa

tccgcggtcttgacccctgataaataagagactacactgaaggaaaataa

ataaataaataaataaatgaatgaatgatatttcttttaaagGACTTTGG

AGATGGAGGAGCTTTTCCAGAGATCCATGTTGCCCAGTATCCTCTGGAAA

TGGGTAGGAAGAAAAGGACGTCCAATGCTCTGGCAGTGCAGGTGGATGCA

GAGGGCAAGATCAAATATGATGCTATTGCTAGACAAGGCCAAAGCAAAGA

CAAGgtacctgatcctcttgtgttatttcatattttattcatatattcag

tggctcttacctaaggatatgatttgttttcataatttttttgttttttt

gaatagGTCATATTTAGTAAATACACAGACATGCTTCCTAAGGAAGTGCT

AAACCAAGATGATCCAGAGCTGTAGAAACCAGATGAAGAGGCAGTGAGAG

AGgtaagattacaattcagtagcagtttctgatagatttcacaattttgt

ttcagtttcacaatcatgcttaagactgctataatgtacccttttgttta

aaaattaaatactataattaaatatttacacaattaatgcatgtcatttt

gaaattatgtaaatgttaacatttttcttaagttactgaagtgaactttg

aataataagaaagcttaacaattttctatcagtgttgtttgatttaatta

acattaggtttgttagtcttcatttacacactagtgtctaatatcagggt

gtctgcagggttttaaaagtcttaatgcttttaaaagcagaaatttagcc

cttaaaagtcttaaattcactaaaatatagtggcataggtcatttcaaac

cggtcttaattttcctgtgtccaagtaaagctaccctaacggactgacac

ccaataatccatcttaaaactattttgtttatatttaagctttttattgc

aaaattatacaattcacaacagcttctagacatttttacagcaaattctc

caaattacatttcctaatcagggaatgaaaactaatgcaacacatccctt

tacatgatcttccattaatataaaaactatttacagaagtaaccaggcta

ttaaaaaaagtccctataaggctgaaatttcactcatattggccttgaaa

gggtcttaaaaagtcttaaattacacttaaagaaacctgctgaaacccta

aatatacatgcactggcttgaaatccttaacttgcattactcttttgtac

tgtggtgttaaaacagcattgataatggaaatatttatgttttaatcaag

cgatcctcatgaaattaaatggtcattacgcagaaccagcatgaattaac

ttttctttttacctccgatgtagCTTACAGAAAAGACCAGATTAGCTCTG

GAGAAACAGGTTTCACAGAAAATCGCGGCAGCTATGCCTGTGCGTGCTGC

AGATAAACAGGCCCCCGCGCAATACATTCGgtaagagtgacttgtgaatg

atgtgaaattgtcgaatttaaataaatgttctggttttagtacaagttag

gctgttttatcagtatgatgttcatttactttaaaaaaaatatactatat

ataaacgtctttcttgttctcaa