SDA1 domain containing 1

cDNA: Genbank AF506206

 

hi297 is in the 5' UTR

 

aattcatcttaagaaaacaatttcaaaagttttaccaggtgctttacata

ttattgttttgcagataaaatgtagattaaaatttcttcaatacttgaag

aaaaaaaatgaaaattaataataacaaataagtacaaaaggtgcatttta

gagcttttgggccccttcgctggaattgtttagggccccgaaatcactaa

atccgcccttggaaaataacagtatagatgtcaaaatctctaccagttta

caacattaaaatatcttattttatgcccaaaagaaacttgtagaaatgac

ttcattttaatgtaagtttgagcttttccttttaagcataaactagcact

tcctaatggtcaaaagtaatcgtcaaatgtaaaaccgaggctgctaaata

cattaattttggccgggaatttgaccgttccaagctggcggacgaacatg

ccatctacgtgttcatatctatgctttcgagtacttactgtcctttcacg

ctttccgtagttTTCTGGCAACATGGCGACCTGCTTATGAGCCACGCTGA

TGCTGAAGTTATCGAAGCCGTCAAAATAAACATTGTTTT

hi (3-5)

CTGACACTTAGTATTAGTTAAATAGCAAAAATGTCGGGTCGTCACAATAA

CAAATTACCGACGAACCTCCCGCAGTTGCAAAATCTGATCAAGAGGGGTC

CGAAGTCCTACACCGAGGAGgtaaataactcgctgtttaacttgtaaagc

aaaacaaataaataatgatttcccaagctgttcgtgtatgtattaaatct

aaccaaacgtttcacgtgtgttcgttagtagcataattaatagcacgtgt

gcttgttttttagtttagttcctgagacaacttgtcacttctattattac

gagaaacgcatttctatagagatct