TCP-1 epsilon

cDNA: Genbank AY648807

 

hi2972b is in the 1st intron

 

gtttggtccgtccctccccgagatTCTTCCAGAACTAGCCGGCAGATCCG

CGCGGTGAGGTGCGCAGCTAGAGGATTAAATTCTCTAGTATAACATCACT

TTTCATAACTGTGCATTTCTTTGGGGTGGAAATTAAACATGTCCGCGCTT

GGGACTCTCGCCTTCGATGAATATGGAAGGCCTTTCATCATCATAAAGGA

CCAGGACAAGAAATCTCGCTTGACTGGCCTGGAAGCACTGAAGgtaacgt

tacaaaagctaacgggctaatgggctataacggagattttaatcatatct

gtaatccagaataccgcatttactgtatactgtagattgattctttatga

aaacgtacttctgcagtctgacatgttaagaatgcattcagttattgcac

atttatttgtctaacgtgatcaacaatgtgcgcatggcaagggatggtcc

atgtgcttcctctagtctagtctaaagacgtcgagtcataatgcgcaatg

ccttcattcattcatca

hi2972b (5-3)

gacatgtcttcatcacattttatttgtggcaatatacttcagttgaatgt

tgttaataaataagtaatgatgatagctatcactctacttcccccaattg

tttgattgcataaagaattgcaaaaagccaaacttttctaaacggacagg

tgcatgtttttgttgtgttttttgggggcttgcagtgtcttgccttgttt

tataatgatagtttcagttctattatttgacaaaaatcctataaagagga

ttgggttgttatttgagacacgccttactaacaaatttttagtttatata

tacatacatacatatacattaaatttatataagatattctaccagaaatg

cacattatctttcccttaaaaccgtaaattgccattcttgcctacccatt

tgagcctcccaagcccaaaaccaagcataagcttggcgtggcatctactg

acatcaatgttatttctgttctcttcagTCTCACATTCTTGCAGCAAAAG

CAGTTGCTAACACCCTGAGAACATCGCTAGGTCCAAATGgtatgttttta

attttgcatgtactcttcctagtttatttcatgctgttttttttaatgct

ggtaaatgttctttacagGACTTGACAAGATGATGGTGGATAAGGATGGT

GAGGTGACCGTGACCAATGATGGTGCGACGATCCTCAGCATGATGGATGT

GGACCATCAGATTGCCAAGCTCATGGTTGAGCTCTCCAAGTCTCAAGATG

ATGAAATTGGAGATGGAACCACTGGTGTTGTTGgtgagcttagcttgata

ttcttcttctccccttttaaaacacaaccacaacactagcaagagcattt

tctttctgtctttgtttaaatgcattgatttgctcgtatataaacatgga

taaatgtacagccttacaaatacattgaaatgcacattataaaaaattta

aaaatcctcttttccaagctgtgtgtacattttatgtgccattacaaaaa

tgagcatgtgtgcatactgttctggagatgatatgctatgggaaatgacc

cagcttatacaaaatctaataataaaaaggccttttacagatctaagaat

gatatatatgctttactttaatatgata