guanine nucleotide binding protein-like 3 (nucleostemin-like)

cDNA: Genbank AY648717

 

hi299 is in the first intron

 

attcaacacggaggttgattgatttattaagaaaccgagaggaaaaaaaa

ttaacccttcgcggcgcgacgagcggaagcggaagtgaggagttgagaca

cgtgctgcTGTTCTGTGAGCGCGTGCTGGAGCTGCGGCAGACATGAAGAG

ACCGAgtgagtgtttaattctgaaacaaatctatatttatacatttaaaa

cgtggatatacgatgtaaatcattatgtggggcaattttgcttgttgtaa

t

hi299 (3-5)

gatgtgaaaacactgttaaatgaggtaaagtgtgctgacggaactcgcac

gtgtctgttttgtagAGTTGAAGAAGGCGAGCAAGCGCTTATCATGCGCT

AAACGCTACAAAATACAAAAGAAGgtaagatatatcaagtgttccttcac

attatataggtaaaactggacttttgtactggcccggttgttgtcagcca

actagagttcgatatcccaaataaaaaaaagtaccatgctttaccatgg