my038-like (retinoblastoma binding protein 6-like)

cDNA: Genbank AY648808

 

hi2993 is just upstream of the gene

 

caccgtttgaactgtatatttccttgatcagagttggaccttacggacag

ctcacggctaaccgccctatggtcttggacattgaaacccggcaggagag

tttctggcttcttgctgggaaattccgtggacttaaatcacttgcgtctt

aaagattgcgtgttgcatttgatcacggtctttctgaacacttgctattt

tcaaatcgcagttgctattcacgtgaggcagaatccacacgacctcctta

gtggagaccttttgatttaacaaaagagtgttgagatgatgagcaaatat

ggctattattcttaaact

approx hi2993 (3-5)

gttaagctgataaacTGATATTGAGTAAGGTTGATCGCTGGGAGAGCCCA

CGCGATCGGGCGAGTTGTAGTTGAGTTTGGTTGTGTGTGGTGGTGGTGTC

TGACCACAAGGAGTGTTTAAACATGTCTTGTGTCCATTACAAGTTTTCTT

CTAAACTTAACTACGACACGGTCACCTTCGATGGCCTTCACATCACGCTC

AGTGATTTGAAACGCCAGATCATGGGGCGAGAGAAGCTGAAGGCCGCGGA

CTGCGACCTGCAAATCACCAACGCTCAGACTAAAGAAGgtaagctggaca

aaatgtgtttgtttgttcaaagtttgttcgagtaattgatactaaccaat

gttaacataagtaaacgcgtaaggtttgttggaaaaggggtttgaattat

tgccttggttaactgttagcttatagctaatgtttgctaacctgtcacca

gcttcgttattatataacttttaaatgggattttatgtcttttaattata

agcttgtaaatgatttgttttattgcgattaattaattgaaagtattgtt

tttaactgtacatttgtgtagtgaagactccattttgtgtgccagcgttt

atgtgtgctcgttacatagacaaaggaatgtgagaggtgttaattaatgg

ttttgccattcttatttttgattacagAATACACTGACGATGAAGCCCTC

ATTCCTAAAAACTCGTCTGTCATCATTAGACGAATCCCTATTGGAGGGCT

TAAGTCGACAAGCAAAACATATGTCATgtaagtacattactacttttaac

ctgcagatgtcttttataaatatttgtacgacaaaaacatctaaaagtgt

tagatgtttcagtagatattagctaggaacattgtaatgtggaaactgct

gtatctcatttacagttctgcatgttcaacattaatatgttgtgatttga

tgtgaggcatgaagggtaaaatgtcatatttagtctcaccttccccaatg

gtgtattatgattgtaaatttaaaataaatgtctccatataaatgaggaa

tagtagcccaattggcatgtaaattttttttttaggctgacaggttaaaa

acatccagtttttattaaaacttcttaaaagtgattaagtgtaata