ring finger protein 113A (zinc finger protein 183-like 1)

cDNA: Genbank AY648809

 

hi3013 is in the 1st intron

 

gtttgtttttatacgtagttaaAGATGGCGGAGTCCGAGGAGCCGAAAAA

ACCCACCTGCACATTTATTTTTAAGAAATCAAACAAGAAATTTTCCGCAC

GGAAAAGAAATGCAAGTGACAGCGACAAAGgtacgttgtgcttctttctt

cagtgtctcaatcgacagcgagtttgacttgagaaac

hi3013 (3-5)

tataatccctacaacaagccgtctgtttaattaatgtttatgctcaatac

atgtctgcagttcagtgttttgtttctttatcatcagAAAAAAGCAGCGG

CGATGAGGGCAGTGCAGTGGTCAGAAAGAAGAAATCTGCCGCTGTGAACC

CCATGATTCAGAAAgtatgtccgtatttcatgtgttttatgtaactagcc

tctgttaaactgatgtcatcataattatatttattattcgttttatagAC

GAAGAAAGTGGAGAGGGAAGCTGTCTCATCGAGTGAAAGTGAAGAAGAGA

AGGAAGAAAAGAGCGTGACTGTCGCTTACAAGTCCACTCGCTCAGCGgtg

agtctgactgacccaacatttgtacagcttca