FLJ11749-like

cDNA: Genbank AY648810

 

hi3017 is in the 1st intron

 

tgaagtacgtatcttccggtaggctgggtagctgttttcttctccacacc

tcagactttagtgtttctgttaTGGACTGACAGTATCGAGGCCTGTGGAT

TTAACATTTTCCGAATTTTAGAAACACCACCCCTGTCTGGACAGATAGTG

GCGGGGATGCGGCATCGACATGGGAAATCTTTTCGGGAAAAAGAAAGCAA

CTCGGGTGACCGAGCAAGACAGAGCTGTGCTGgtgtgtttgaaaactgct

aactggctaatcattatgattagagaacttgtatatgtaaaactcgggtg

ttatattatcttaatatgtt

hi3017 (3-5)

tatgtgtttaaatttgtatatcttcaggaaacgcacctaaaggaccgtta

gtctacatatacctctcatttttaatattaatattaaatgtgtcacttat

ttatgtgtgtgagcagCAACTGAAACAGCAGAGAGATAAACTGAAGCAGT

ATCAGAAGAGGATCACGCTTCAGATGGACAAGGAGCGACAACTGGCCAAA

CAGTTACTGAAAGATGGCAAGAAAGAgtgagtacagtcatgtatgactta

ctgtgacttgtagaactagaaggtcaagcttttcataaaaactaccttct

aatgttttgtgtgtatagTAAAGCACTCCTACTCCTGAAGAAGAAACGCT

ACCAGGATCAGTTACTGGAAAAGACAGAAAATCAAATTAGTAACCTGGAG

CGAATGgtaaataaagcattttatgctgaggacatgatgaatgacacatg

ttgacaagactgcag