U1 small nuclear ribonucleoprotein polypeptide A

cDNA: Genbank AY648811

 

hi3018a is in the 1st intron, before the ATG

 

atgtaccactagacgtaaatgtgtcgtgaaacaccgcagcggtttacggc

ctcgcgccattttaagaaaggaacgactcgttcaactgggtgagaacaca

CGTTGGGTATTGTGTGGACCGAAATACACACAAAAATACCGAGTGAATTA

AAGAAATTCATGCACGAAGGTCTTCCACAGAAACACGCAAGAGGATTTTG

GCCCGAAAATCGGAGATTTCGTTGGAGCCGAATGAAAAACTGAGgtaatt

gactgcaggaggccgtccgtggaaatgtaggcgatctcggatatgatcat

catgagagagttggtgaattagcagagctgaccgtaaccacgactaagct

ttgctttatatgtgtgtattaaagagtgcactgatattagttattagatg

cgtctctttttgttgatgctacactaacgtgatctgatgctgaagttgta

gtttgtttaatcatt

hi3018a (5-3)

atgtggagaataaaagtgtttgtttgcacgaagctaaccgagaaagctaa

gactgctagcagctaacttcacgagactcgtttaaggggtgtttgtttac

tgatccagatctatgtgaagacgctgaattttcagtttgaatctgttagc

atgattttgtctgcttatttaaatccaccttatcttaaataacgtcttat

ttaccattttcacacagtaactgcttaacttgcatgaggtgctcctagtt

gttgattattttttttatcgtttgtgttttttctctcttccagGTGAACA

ATGACTCAGTTTTTTCCGCCGAACCTGTTGGCATTGTTTGCCCCGCGGGA

CCCCATACCGTTCCTGCCTCAACTGGGAAAGCTTCCTCACGAGAAACACC

ACAACCAGCCCTACTGCGGAATTGCTCCTTTTATCCGGCATTTTGAGgtg

ctttttgacttgttattttatgtagaacggtttatttatcgatttctttg

ttacattgatgtataactgttttttctgctgtttattagGACCCCAGAGA

TGCCCCTCCACCCACAAGAGCAGAGACACGGGAGGAGAGACTGGAGAGGA

AGgtgagcgagacttgtctgaatagactctctgtggggagtttactaatg

ttttctcctgctgaattgcttttagattgacagagctgcactcagtagtt

ttaggccccgtttacactagtgcgttttagtttgaaaacgcataagtttt

gctacggttacgcca