beta-1,3-glucuronyltransferase-3-like

cDNA: Genbank AF506207

 

hi307 is in the 5' UTR

hi4205 is in the first intron

 

agcttaatttacaatggtaaggaaatgtaatcagtagtttacagaaatga

aattgtagaagaaatgcacattttaattcatagtatagaataaatgacta

tatattacatgtacttaatccccagtacattctaatcaatgcactctgca

aatttcaatataaatgcaagtaataactagtttatttaatatttttaaat

aattttttaaaaagtaaaataattttctttttcaattatgtttttacgct

ttttcttagtcacatttaacaataaaaagtcgtcaagcggaactatcgcg

tgcttccacgcctccggagaccattgattgcgttgcacactgagagcgga

agttgctggtagtccgcagcggatgaatggattcgctgtccactcTGCAC

TTCATTAGTGTTTGCGCAGAGACGCGTCTGTAAAACAATGAAGCGACCGA

AGAGGACGTTATTCATCTCGGCTTTAAATTAACGTACACCACCGAGAGTG

ACATGCAGTCTTTGTAACCGTAAATGATTACAAACTAACAGAGCGAACTA

AAAATCAAGATAGAGTCACAGGATG

hi307 (3-5)

TACTTTACTTTAGGTAACGTTAACGTTAGCGGTATCTATTGTCATTCTCC

CCAAGCTGCAGTCGTGCTCGTCGCAATGAGTTTCCATGGGCGGAGTGTGT

AAAAACCAAGGGTCTCCTTCAGTCTCGGCTCCAGCATCAGCAGCAGGTCA

TCATGAGGATGAGACTGAAGCTGAAGACAGTGTTTGTCCTGTACTTCATG

GTGTCTCTGTTTGGGCTCCTGTACGCGCTGATGCAGCTCGgtaagactgc

actctctgtcagcgtggacttgctttattctgtgtgttttgcattattaa

caagaactagcatgtgcagtctcgtagttcattatacaaccacaattttt

cacatgccttgaaagcaggggtcaccaatctcg

hi4205 (5-3)

gtcctggagggccggtgtccctgctgggtttagctccaacttgcctcaac

acacctgcctgggtgtttcaagtatacctagcaagaccttgattatcttg

ttcaggtgtgtttgattagggttggagctaaaatctccaggagaccggcc

ctccaggaacaagtttggtgacccctgccttaaagggatgaaattctgcc

atcattcactcgtctcaaaccttgagtttttcttctgatggacacaaaag

aagatatttagaagaaagttggaagtctgtaatcattgacatccatggtg

tttttcatgctgtagaagccaatggttttcagctttcttcaaagtatctt

tgtgtgaaacagaagaaaaccctctaaaagttgagtaaacagagtaaatt

ttcaaaaaatctcatttttgagattaacaagagataaaaaaaagaagagg

ttgcatattatcatcaatttacaaacaattaaacacactttagaagttgt

ccacatccgtaagatattaaaatgcactgttaaagggatagttcatccaa

aaatggaattttactccgtatttactcaccttcaagtggttccacacctt

tatgagtttatttttctgttgaacataaaagacgttatttagaagaaagc

tggaagtctgtaatcatttgacgctttgggtcttagaaaagcgcattata

aattaaaaactaaataaataaataattaaatgtattattacacccatagt

gtttgttttcatactatggaagtctgcggttttcagctttcttcaaagta

tcttctttttgctaaacagaagaaaacccggtaaaggtttgaaccatgta

aaggttgagtaaatagagagtacattttaatttttgaggttaacaaaagt

taaaaaagaagagaggggtaagaatcatcaatttgcaaacaaacacgcat

acaatctatcagattacattaaaccatctgtcaggaatcga